Incidental Mutation 'R8946:Skint7'
ID 681284
Institutional Source Beutler Lab
Gene Symbol Skint7
Ensembl Gene ENSMUSG00000049214
Gene Name selection and upkeep of intraepithelial T cells 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8946 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 111972923-111988223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111982001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 164 (N164S)
Ref Sequence ENSEMBL: ENSMUSP00000127347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055014] [ENSMUST00000106568] [ENSMUST00000163281]
AlphaFold A7XV04
Predicted Effect possibly damaging
Transcript: ENSMUST00000055014
AA Change: N164S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054822
Gene: ENSMUSG00000049214
AA Change: N164S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106568
AA Change: N164S

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102178
Gene: ENSMUSG00000049214
AA Change: N164S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163281
AA Change: N164S

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127347
Gene: ENSMUSG00000049214
AA Change: N164S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,354,368 S393G probably damaging Het
Ankrd28 A G 14: 31,708,126 F862L probably damaging Het
Ankrd31 T C 13: 96,909,529 *1546Q probably null Het
Ankrd33b T C 15: 31,297,748 T288A probably benign Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Atp13a5 A G 16: 29,327,783 L231P probably damaging Het
C1qtnf12 T C 4: 155,966,425 F284L probably damaging Het
Caprin1 A T 2: 103,778,033 H250Q probably damaging Het
Cd2bp2 A C 7: 127,194,751 I122S probably damaging Het
Cd300lf T A 11: 115,133,912 probably benign Het
Ceacam14 A G 7: 17,814,074 I30V probably benign Het
Chchd1 T A 14: 20,703,317 *56R probably null Het
Ckap5 A G 2: 91,579,516 T948A probably benign Het
Clec12a A T 6: 129,363,986 N243I possibly damaging Het
Col11a2 A G 17: 34,051,783 M462V probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Csnka2ip T C 16: 64,480,304 probably benign Het
D130040H23Rik C A 8: 69,302,381 T146N possibly damaging Het
Dennd5b T C 6: 149,041,987 probably benign Het
E130309D02Rik C G 5: 143,315,040 E19Q probably benign Het
Fanci A G 7: 79,395,978 T23A probably benign Het
Fmnl1 T C 11: 103,180,915 Y83H probably damaging Het
Galnt13 C A 2: 54,880,063 T289N probably benign Het
Gcn1l1 A G 5: 115,595,345 D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Gm5415 C T 1: 32,546,604 R75Q probably benign Het
Gnl1 T C 17: 35,983,587 I366T probably benign Het
Gtf2ird2 A T 5: 134,216,319 Y473F probably damaging Het
Ikzf1 T A 11: 11,769,485 D397E possibly damaging Het
Intu C T 3: 40,683,359 A425V possibly damaging Het
Jakmip1 G A 5: 37,185,740 probably null Het
Lif C A 11: 4,269,225 P168Q possibly damaging Het
Mrvi1 A T 7: 110,878,140 probably null Het
Myh11 A C 16: 14,230,716 S576A probably benign Het
Neb A G 2: 52,151,413 V6559A probably damaging Het
Nphs1 A G 7: 30,463,200 N368S probably damaging Het
Npsr1 G A 9: 24,313,229 V148I probably benign Het
Olfr1465 A T 19: 13,314,138 L49Q probably damaging Het
Olfr566 C A 7: 102,856,518 G255* probably null Het
Olfr599 T C 7: 103,338,366 F104S probably damaging Het
Olfr683 T A 7: 105,143,625 I223F probably damaging Het
Olfr857 C T 9: 19,713,589 T254I probably damaging Het
Patz1 T C 11: 3,291,856 C415R probably damaging Het
Pcdha9 A T 18: 36,998,493 N205I possibly damaging Het
Pcdhga12 A T 18: 37,766,658 E181V probably benign Het
Pcnx T C 12: 81,971,384 Y1333H probably damaging Het
Phf7 A T 14: 31,248,149 probably benign Het
Pomc T G 12: 3,960,298 S180A probably benign Het
Ppp1r7 T A 1: 93,360,814 probably null Het
Prrc2c A T 1: 162,708,909 probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,579,906 probably benign Het
Senp1 T C 15: 98,042,901 K664E probably damaging Het
Smg1 C A 7: 118,152,677 R2775M probably null Het
Snrnp27 C T 6: 86,676,244 V131M probably damaging Het
Spire1 C A 18: 67,496,616 R357L probably damaging Het
Sspo G A 6: 48,457,137 V959I probably damaging Het
St6galnac2 T C 11: 116,677,632 H335R probably damaging Het
Stard13 C T 5: 151,060,802 R623H probably damaging Het
Syde1 T A 10: 78,588,849 E383V probably damaging Het
Taf10 A G 7: 105,744,317 M1T probably null Het
Traf3ip3 A G 1: 193,187,107 C257R probably damaging Het
Trpm8 G A 1: 88,348,339 probably benign Het
Veph1 A G 3: 66,263,880 probably null Het
Vmn1r169 A T 7: 23,577,215 T11S possibly damaging Het
Wdhd1 A T 14: 47,245,295 S961T probably benign Het
Zfp773 T C 7: 7,132,470 T376A possibly damaging Het
Other mutations in Skint7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Skint7 APN 4 111982205 missense probably damaging 1.00
IGL01697:Skint7 APN 4 111980457 splice site probably benign
IGL01961:Skint7 APN 4 111977463 missense probably benign 0.01
IGL02232:Skint7 APN 4 111982028 missense possibly damaging 0.70
IGL02675:Skint7 APN 4 111981981 missense probably benign 0.03
IGL02729:Skint7 APN 4 111982170 missense probably benign 0.01
IGL02887:Skint7 APN 4 111982178 missense possibly damaging 0.70
Fraction UTSW 4 111980178 missense probably damaging 0.99
ratio UTSW 4 111984876 splice site probably null
R0315:Skint7 UTSW 4 111988118 missense possibly damaging 0.61
R0401:Skint7 UTSW 4 111980362 missense probably damaging 0.96
R0545:Skint7 UTSW 4 111980198 missense probably benign 0.08
R0607:Skint7 UTSW 4 111977459 nonsense probably null
R0685:Skint7 UTSW 4 111980345 missense possibly damaging 0.71
R1130:Skint7 UTSW 4 111984158 missense probably benign 0.23
R1340:Skint7 UTSW 4 111980219 missense probably damaging 1.00
R1350:Skint7 UTSW 4 111980324 missense possibly damaging 0.78
R1764:Skint7 UTSW 4 111982073 missense probably benign 0.00
R1804:Skint7 UTSW 4 111982012 missense probably damaging 1.00
R2005:Skint7 UTSW 4 111984850 missense probably benign 0.13
R2084:Skint7 UTSW 4 111980178 missense probably damaging 0.99
R4651:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R4652:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R5070:Skint7 UTSW 4 111984134 missense probably damaging 1.00
R5088:Skint7 UTSW 4 111980430 missense possibly damaging 0.78
R5096:Skint7 UTSW 4 111981955 missense probably damaging 0.98
R5311:Skint7 UTSW 4 111980304 missense probably damaging 0.99
R5524:Skint7 UTSW 4 111980349 missense probably damaging 1.00
R5777:Skint7 UTSW 4 111988092 missense probably benign 0.29
R6208:Skint7 UTSW 4 111984876 splice site probably null
R6369:Skint7 UTSW 4 111980293 missense probably benign 0.16
R6752:Skint7 UTSW 4 111980266 missense probably benign 0.21
R7396:Skint7 UTSW 4 111988127 missense probably benign
R7633:Skint7 UTSW 4 111984140 missense probably benign 0.27
R7840:Skint7 UTSW 4 111982226 missense probably benign
R8054:Skint7 UTSW 4 111982229 missense probably benign
R8253:Skint7 UTSW 4 111977478 nonsense probably null
R8840:Skint7 UTSW 4 111987986 missense probably benign
Z1176:Skint7 UTSW 4 111980129 missense probably benign 0.01
Z1177:Skint7 UTSW 4 111980235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATAGACATCAAATGCTAACTG -3'
(R):5'- CTGTTACAGGGTTGAAAATACAGC -3'

Sequencing Primer
(F):5'- GACATCAAATGCTAACTGGTTACTC -3'
(R):5'- CAAATGATGCTGCCATGTGAC -3'
Posted On 2021-08-31