Incidental Mutation 'R8946:Ceacam14'
ID 681295
Institutional Source Beutler Lab
Gene Symbol Ceacam14
Ensembl Gene ENSMUSG00000023185
Gene Name carcinoembryonic antigen-related cell adhesion molecule 14
Synonyms 1600025E09Rik, 1600021E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8946 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 17812633-17815663 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17814074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 30 (I30V)
Ref Sequence ENSEMBL: ENSMUSP00000023953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023953]
AlphaFold Q78Y72
Predicted Effect probably benign
Transcript: ENSMUST00000023953
AA Change: I30V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023953
Gene: ENSMUSG00000023185
AA Change: I30V

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
IG_like 40 141 6.35e0 SMART
IG_like 158 261 2.73e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,354,368 S393G probably damaging Het
Ankrd28 A G 14: 31,708,126 F862L probably damaging Het
Ankrd31 T C 13: 96,909,529 *1546Q probably null Het
Ankrd33b T C 15: 31,297,748 T288A probably benign Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Atp13a5 A G 16: 29,327,783 L231P probably damaging Het
C1qtnf12 T C 4: 155,966,425 F284L probably damaging Het
Caprin1 A T 2: 103,778,033 H250Q probably damaging Het
Cd2bp2 A C 7: 127,194,751 I122S probably damaging Het
Cd300lf T A 11: 115,133,912 probably benign Het
Chchd1 T A 14: 20,703,317 *56R probably null Het
Ckap5 A G 2: 91,579,516 T948A probably benign Het
Clec12a A T 6: 129,363,986 N243I possibly damaging Het
Col11a2 A G 17: 34,051,783 M462V probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Csnka2ip T C 16: 64,480,304 probably benign Het
D130040H23Rik C A 8: 69,302,381 T146N possibly damaging Het
Dennd5b T C 6: 149,041,987 probably benign Het
E130309D02Rik C G 5: 143,315,040 E19Q probably benign Het
Fanci A G 7: 79,395,978 T23A probably benign Het
Fmnl1 T C 11: 103,180,915 Y83H probably damaging Het
Galnt13 C A 2: 54,880,063 T289N probably benign Het
Gcn1l1 A G 5: 115,595,345 D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Gm5415 C T 1: 32,546,604 R75Q probably benign Het
Gnl1 T C 17: 35,983,587 I366T probably benign Het
Gtf2ird2 A T 5: 134,216,319 Y473F probably damaging Het
Ikzf1 T A 11: 11,769,485 D397E possibly damaging Het
Intu C T 3: 40,683,359 A425V possibly damaging Het
Jakmip1 G A 5: 37,185,740 probably null Het
Lif C A 11: 4,269,225 P168Q possibly damaging Het
Mrvi1 A T 7: 110,878,140 probably null Het
Myh11 A C 16: 14,230,716 S576A probably benign Het
Neb A G 2: 52,151,413 V6559A probably damaging Het
Nphs1 A G 7: 30,463,200 N368S probably damaging Het
Npsr1 G A 9: 24,313,229 V148I probably benign Het
Olfr1465 A T 19: 13,314,138 L49Q probably damaging Het
Olfr566 C A 7: 102,856,518 G255* probably null Het
Olfr599 T C 7: 103,338,366 F104S probably damaging Het
Olfr683 T A 7: 105,143,625 I223F probably damaging Het
Olfr857 C T 9: 19,713,589 T254I probably damaging Het
Patz1 T C 11: 3,291,856 C415R probably damaging Het
Pcdha9 A T 18: 36,998,493 N205I possibly damaging Het
Pcdhga12 A T 18: 37,766,658 E181V probably benign Het
Pcnx T C 12: 81,971,384 Y1333H probably damaging Het
Phf7 A T 14: 31,248,149 probably benign Het
Pomc T G 12: 3,960,298 S180A probably benign Het
Ppp1r7 T A 1: 93,360,814 probably null Het
Prrc2c A T 1: 162,708,909 probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,579,906 probably benign Het
Senp1 T C 15: 98,042,901 K664E probably damaging Het
Skint7 A G 4: 111,982,001 N164S possibly damaging Het
Smg1 C A 7: 118,152,677 R2775M probably null Het
Snrnp27 C T 6: 86,676,244 V131M probably damaging Het
Spire1 C A 18: 67,496,616 R357L probably damaging Het
Sspo G A 6: 48,457,137 V959I probably damaging Het
St6galnac2 T C 11: 116,677,632 H335R probably damaging Het
Stard13 C T 5: 151,060,802 R623H probably damaging Het
Syde1 T A 10: 78,588,849 E383V probably damaging Het
Taf10 A G 7: 105,744,317 M1T probably null Het
Traf3ip3 A G 1: 193,187,107 C257R probably damaging Het
Trpm8 G A 1: 88,348,339 probably benign Het
Veph1 A G 3: 66,263,880 probably null Het
Vmn1r169 A T 7: 23,577,215 T11S possibly damaging Het
Wdhd1 A T 14: 47,245,295 S961T probably benign Het
Zfp773 T C 7: 7,132,470 T376A possibly damaging Het
Other mutations in Ceacam14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ceacam14 APN 7 17814137 missense probably damaging 1.00
R0452:Ceacam14 UTSW 7 17815323 missense probably benign
R1613:Ceacam14 UTSW 7 17814048 splice site probably benign
R1990:Ceacam14 UTSW 7 17815365 nonsense probably null
R2153:Ceacam14 UTSW 7 17814228 missense probably benign 0.00
R3887:Ceacam14 UTSW 7 17814138 missense probably damaging 1.00
R4724:Ceacam14 UTSW 7 17814050 critical splice acceptor site probably null
R5323:Ceacam14 UTSW 7 17815477 makesense probably null
R5454:Ceacam14 UTSW 7 17814185 missense probably damaging 1.00
R5696:Ceacam14 UTSW 7 17814342 missense probably damaging 0.97
R6318:Ceacam14 UTSW 7 17814312 missense probably damaging 1.00
R6763:Ceacam14 UTSW 7 17815343 missense probably benign 0.04
R7607:Ceacam14 UTSW 7 17814321 missense possibly damaging 0.95
R7789:Ceacam14 UTSW 7 17814171 missense probably damaging 0.99
R9781:Ceacam14 UTSW 7 17815157 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CAGAACAGGTTCAGGGCAAC -3'
(R):5'- AAGTCCGATCACAGTAGCATTG -3'

Sequencing Primer
(F):5'- CAGTGGAGGTTATATTGTTCACCCC -3'
(R):5'- GTCCGATCACAGTAGCATTGATAGC -3'
Posted On 2021-08-31