Incidental Mutation 'R8946:Nphs1'
ID 681297
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8946 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30463200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 368 (N368S)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: N368S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: N368S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: N354S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: N354S

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,354,368 S393G probably damaging Het
Ankrd28 A G 14: 31,708,126 F862L probably damaging Het
Ankrd31 T C 13: 96,909,529 *1546Q probably null Het
Ankrd33b T C 15: 31,297,748 T288A probably benign Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Atp13a5 A G 16: 29,327,783 L231P probably damaging Het
C1qtnf12 T C 4: 155,966,425 F284L probably damaging Het
Caprin1 A T 2: 103,778,033 H250Q probably damaging Het
Cd2bp2 A C 7: 127,194,751 I122S probably damaging Het
Cd300lf T A 11: 115,133,912 probably benign Het
Ceacam14 A G 7: 17,814,074 I30V probably benign Het
Chchd1 T A 14: 20,703,317 *56R probably null Het
Ckap5 A G 2: 91,579,516 T948A probably benign Het
Clec12a A T 6: 129,363,986 N243I possibly damaging Het
Col11a2 A G 17: 34,051,783 M462V probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Csnka2ip T C 16: 64,480,304 probably benign Het
D130040H23Rik C A 8: 69,302,381 T146N possibly damaging Het
Dennd5b T C 6: 149,041,987 probably benign Het
E130309D02Rik C G 5: 143,315,040 E19Q probably benign Het
Fanci A G 7: 79,395,978 T23A probably benign Het
Fmnl1 T C 11: 103,180,915 Y83H probably damaging Het
Galnt13 C A 2: 54,880,063 T289N probably benign Het
Gcn1l1 A G 5: 115,595,345 D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Gm5415 C T 1: 32,546,604 R75Q probably benign Het
Gnl1 T C 17: 35,983,587 I366T probably benign Het
Gtf2ird2 A T 5: 134,216,319 Y473F probably damaging Het
Ikzf1 T A 11: 11,769,485 D397E possibly damaging Het
Intu C T 3: 40,683,359 A425V possibly damaging Het
Jakmip1 G A 5: 37,185,740 probably null Het
Lif C A 11: 4,269,225 P168Q possibly damaging Het
Mrvi1 A T 7: 110,878,140 probably null Het
Myh11 A C 16: 14,230,716 S576A probably benign Het
Neb A G 2: 52,151,413 V6559A probably damaging Het
Npsr1 G A 9: 24,313,229 V148I probably benign Het
Olfr1465 A T 19: 13,314,138 L49Q probably damaging Het
Olfr566 C A 7: 102,856,518 G255* probably null Het
Olfr599 T C 7: 103,338,366 F104S probably damaging Het
Olfr683 T A 7: 105,143,625 I223F probably damaging Het
Olfr857 C T 9: 19,713,589 T254I probably damaging Het
Patz1 T C 11: 3,291,856 C415R probably damaging Het
Pcdha9 A T 18: 36,998,493 N205I possibly damaging Het
Pcdhga12 A T 18: 37,766,658 E181V probably benign Het
Pcnx T C 12: 81,971,384 Y1333H probably damaging Het
Phf7 A T 14: 31,248,149 probably benign Het
Pomc T G 12: 3,960,298 S180A probably benign Het
Ppp1r7 T A 1: 93,360,814 probably null Het
Prrc2c A T 1: 162,708,909 probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,579,906 probably benign Het
Senp1 T C 15: 98,042,901 K664E probably damaging Het
Skint7 A G 4: 111,982,001 N164S possibly damaging Het
Smg1 C A 7: 118,152,677 R2775M probably null Het
Snrnp27 C T 6: 86,676,244 V131M probably damaging Het
Spire1 C A 18: 67,496,616 R357L probably damaging Het
Sspo G A 6: 48,457,137 V959I probably damaging Het
St6galnac2 T C 11: 116,677,632 H335R probably damaging Het
Stard13 C T 5: 151,060,802 R623H probably damaging Het
Syde1 T A 10: 78,588,849 E383V probably damaging Het
Taf10 A G 7: 105,744,317 M1T probably null Het
Traf3ip3 A G 1: 193,187,107 C257R probably damaging Het
Trpm8 G A 1: 88,348,339 probably benign Het
Veph1 A G 3: 66,263,880 probably null Het
Vmn1r169 A T 7: 23,577,215 T11S possibly damaging Het
Wdhd1 A T 14: 47,245,295 S961T probably benign Het
Zfp773 T C 7: 7,132,470 T376A possibly damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTCCATTCCCAGACG -3'
(R):5'- GGACACATGAAACTTTCCCATC -3'

Sequencing Primer
(F):5'- ATTCCCAGACGGCCTTATGTG -3'
(R):5'- AGGAACTGGAGCCTCAGTCTG -3'
Posted On 2021-08-31