Incidental Mutation 'R8946:Nphs1'
ID 681297
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 068784-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8946 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30162625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 368 (N368S)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: N368S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: N368S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: N354S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: N354S

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,304,368 (GRCm39) S393G probably damaging Het
Ankrd28 A G 14: 31,430,083 (GRCm39) F862L probably damaging Het
Ankrd31 T C 13: 97,046,037 (GRCm39) *1546Q probably null Het
Ankrd33b T C 15: 31,297,894 (GRCm39) T288A probably benign Het
Aox1 T C 1: 58,145,227 (GRCm39) I1331T possibly damaging Het
Atp13a5 A G 16: 29,146,601 (GRCm39) L231P probably damaging Het
C1qtnf12 T C 4: 156,050,882 (GRCm39) F284L probably damaging Het
Caprin1 A T 2: 103,608,378 (GRCm39) H250Q probably damaging Het
Cd2bp2 A C 7: 126,793,923 (GRCm39) I122S probably damaging Het
Cd300lf T A 11: 115,024,738 (GRCm39) probably benign Het
Ceacam14 A G 7: 17,547,999 (GRCm39) I30V probably benign Het
Chchd1 T A 14: 20,753,385 (GRCm39) *56R probably null Het
Ckap5 A G 2: 91,409,861 (GRCm39) T948A probably benign Het
Clec12a A T 6: 129,340,949 (GRCm39) N243I possibly damaging Het
Col11a2 A G 17: 34,270,757 (GRCm39) M462V probably benign Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Csnka2ip T C 16: 64,300,667 (GRCm39) probably benign Het
D130040H23Rik C A 8: 69,755,033 (GRCm39) T146N possibly damaging Het
Dennd5b T C 6: 148,943,485 (GRCm39) probably benign Het
Fanci A G 7: 79,045,726 (GRCm39) T23A probably benign Het
Fmnl1 T C 11: 103,071,741 (GRCm39) Y83H probably damaging Het
Galnt13 C A 2: 54,770,075 (GRCm39) T289N probably benign Het
Gcn1 A G 5: 115,733,404 (GRCm39) D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,492,669 (GRCm39) probably null Het
Gnl1 T C 17: 36,294,479 (GRCm39) I366T probably benign Het
Gtf2ird2 A T 5: 134,245,161 (GRCm39) Y473F probably damaging Het
Ikzf1 T A 11: 11,719,485 (GRCm39) D397E possibly damaging Het
Ints15 C G 5: 143,300,795 (GRCm39) E19Q probably benign Het
Intu C T 3: 40,637,789 (GRCm39) A425V possibly damaging Het
Irag1 A T 7: 110,477,347 (GRCm39) probably null Het
Jakmip1 G A 5: 37,343,084 (GRCm39) probably null Het
Lif C A 11: 4,219,225 (GRCm39) P168Q possibly damaging Het
Myh11 A C 16: 14,048,580 (GRCm39) S576A probably benign Het
Neb A G 2: 52,041,425 (GRCm39) V6559A probably damaging Het
Npsr1 G A 9: 24,224,525 (GRCm39) V148I probably benign Het
Or51f1 C A 7: 102,505,725 (GRCm39) G255* probably null Het
Or52ab4 T C 7: 102,987,573 (GRCm39) F104S probably damaging Het
Or56a5 T A 7: 104,792,832 (GRCm39) I223F probably damaging Het
Or5b111 A T 19: 13,291,502 (GRCm39) L49Q probably damaging Het
Or7e166 C T 9: 19,624,885 (GRCm39) T254I probably damaging Het
Patz1 T C 11: 3,241,856 (GRCm39) C415R probably damaging Het
Pcdha9 A T 18: 37,131,546 (GRCm39) N205I possibly damaging Het
Pcdhga12 A T 18: 37,899,711 (GRCm39) E181V probably benign Het
Pcnx1 T C 12: 82,018,158 (GRCm39) Y1333H probably damaging Het
Phf7 A T 14: 30,970,106 (GRCm39) probably benign Het
Pomc T G 12: 4,010,298 (GRCm39) S180A probably benign Het
Ppp1r7 T A 1: 93,288,536 (GRCm39) probably null Het
Prrc2c A T 1: 162,536,478 (GRCm39) probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,229,113 (GRCm39) probably benign Het
Semp2l1 C T 1: 32,585,685 (GRCm39) R75Q probably benign Het
Senp1 T C 15: 97,940,782 (GRCm39) K664E probably damaging Het
Skint7 A G 4: 111,839,198 (GRCm39) N164S possibly damaging Het
Smg1 C A 7: 117,751,900 (GRCm39) R2775M probably null Het
Snrnp27 C T 6: 86,653,226 (GRCm39) V131M probably damaging Het
Spire1 C A 18: 67,629,686 (GRCm39) R357L probably damaging Het
Sspo G A 6: 48,434,071 (GRCm39) V959I probably damaging Het
St6galnac2 T C 11: 116,568,458 (GRCm39) H335R probably damaging Het
Stard13 C T 5: 150,984,267 (GRCm39) R623H probably damaging Het
Syde1 T A 10: 78,424,683 (GRCm39) E383V probably damaging Het
Taf10 A G 7: 105,393,524 (GRCm39) M1T probably null Het
Traf3ip3 A G 1: 192,869,415 (GRCm39) C257R probably damaging Het
Trpm8 G A 1: 88,276,061 (GRCm39) probably benign Het
Veph1 A G 3: 66,171,301 (GRCm39) probably null Het
Vmn1r169 A T 7: 23,276,640 (GRCm39) T11S possibly damaging Het
Wdhd1 A T 14: 47,482,752 (GRCm39) S961T probably benign Het
Zfp773 T C 7: 7,135,469 (GRCm39) T376A possibly damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R1937:Nphs1 UTSW 7 30,173,798 (GRCm39) missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30,162,657 (GRCm39) missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30,163,284 (GRCm39) missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9720:Nphs1 UTSW 7 30,165,499 (GRCm39) missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTCCATTCCCAGACG -3'
(R):5'- GGACACATGAAACTTTCCCATC -3'

Sequencing Primer
(F):5'- ATTCCCAGACGGCCTTATGTG -3'
(R):5'- AGGAACTGGAGCCTCAGTCTG -3'
Posted On 2021-08-31