Incidental Mutation 'R8946:Fmnl1'
ID 681316
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8946 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103180915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 83 (Y83H)
Ref Sequence ENSEMBL: ENSMUSP00000151439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect probably damaging
Transcript: ENSMUST00000042286
AA Change: Y83H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: Y83H

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107027
AA Change: Y83H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: Y83H

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218163
AA Change: Y83H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,354,368 S393G probably damaging Het
Ankrd28 A G 14: 31,708,126 F862L probably damaging Het
Ankrd31 T C 13: 96,909,529 *1546Q probably null Het
Ankrd33b T C 15: 31,297,748 T288A probably benign Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Atp13a5 A G 16: 29,327,783 L231P probably damaging Het
C1qtnf12 T C 4: 155,966,425 F284L probably damaging Het
Caprin1 A T 2: 103,778,033 H250Q probably damaging Het
Cd2bp2 A C 7: 127,194,751 I122S probably damaging Het
Cd300lf T A 11: 115,133,912 probably benign Het
Ceacam14 A G 7: 17,814,074 I30V probably benign Het
Chchd1 T A 14: 20,703,317 *56R probably null Het
Ckap5 A G 2: 91,579,516 T948A probably benign Het
Clec12a A T 6: 129,363,986 N243I possibly damaging Het
Col11a2 A G 17: 34,051,783 M462V probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Csnka2ip T C 16: 64,480,304 probably benign Het
D130040H23Rik C A 8: 69,302,381 T146N possibly damaging Het
Dennd5b T C 6: 149,041,987 probably benign Het
E130309D02Rik C G 5: 143,315,040 E19Q probably benign Het
Fanci A G 7: 79,395,978 T23A probably benign Het
Galnt13 C A 2: 54,880,063 T289N probably benign Het
Gcn1l1 A G 5: 115,595,345 D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Gm5415 C T 1: 32,546,604 R75Q probably benign Het
Gnl1 T C 17: 35,983,587 I366T probably benign Het
Gtf2ird2 A T 5: 134,216,319 Y473F probably damaging Het
Ikzf1 T A 11: 11,769,485 D397E possibly damaging Het
Intu C T 3: 40,683,359 A425V possibly damaging Het
Jakmip1 G A 5: 37,185,740 probably null Het
Lif C A 11: 4,269,225 P168Q possibly damaging Het
Mrvi1 A T 7: 110,878,140 probably null Het
Myh11 A C 16: 14,230,716 S576A probably benign Het
Neb A G 2: 52,151,413 V6559A probably damaging Het
Nphs1 A G 7: 30,463,200 N368S probably damaging Het
Npsr1 G A 9: 24,313,229 V148I probably benign Het
Olfr1465 A T 19: 13,314,138 L49Q probably damaging Het
Olfr566 C A 7: 102,856,518 G255* probably null Het
Olfr599 T C 7: 103,338,366 F104S probably damaging Het
Olfr683 T A 7: 105,143,625 I223F probably damaging Het
Olfr857 C T 9: 19,713,589 T254I probably damaging Het
Patz1 T C 11: 3,291,856 C415R probably damaging Het
Pcdha9 A T 18: 36,998,493 N205I possibly damaging Het
Pcdhga12 A T 18: 37,766,658 E181V probably benign Het
Pcnx T C 12: 81,971,384 Y1333H probably damaging Het
Phf7 A T 14: 31,248,149 probably benign Het
Pomc T G 12: 3,960,298 S180A probably benign Het
Ppp1r7 T A 1: 93,360,814 probably null Het
Prrc2c A T 1: 162,708,909 probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,579,906 probably benign Het
Senp1 T C 15: 98,042,901 K664E probably damaging Het
Skint7 A G 4: 111,982,001 N164S possibly damaging Het
Smg1 C A 7: 118,152,677 R2775M probably null Het
Snrnp27 C T 6: 86,676,244 V131M probably damaging Het
Spire1 C A 18: 67,496,616 R357L probably damaging Het
Sspo G A 6: 48,457,137 V959I probably damaging Het
St6galnac2 T C 11: 116,677,632 H335R probably damaging Het
Stard13 C T 5: 151,060,802 R623H probably damaging Het
Syde1 T A 10: 78,588,849 E383V probably damaging Het
Taf10 A G 7: 105,744,317 M1T probably null Het
Traf3ip3 A G 1: 193,187,107 C257R probably damaging Het
Trpm8 G A 1: 88,348,339 probably benign Het
Veph1 A G 3: 66,263,880 probably null Het
Vmn1r169 A T 7: 23,577,215 T11S possibly damaging Het
Wdhd1 A T 14: 47,245,295 S961T probably benign Het
Zfp773 T C 7: 7,132,470 T376A possibly damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATGGCCAAAGTTTGTGCC -3'
(R):5'- TGTATGGACTCAGGGATACACAAG -3'

Sequencing Primer
(F):5'- GCCTTTGGTATTTCAGAAGCAG -3'
(R):5'- TCTATGCATGAATACACAGGGTGC -3'
Posted On 2021-08-31