Incidental Mutation 'R8947:Sf3b1'
ID 681337
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Name splicing factor 3b, subunit 1
Synonyms Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 55024328-55066640 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55039444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 727 (V727E)
Ref Sequence ENSEMBL: ENSMUSP00000027127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027127
AA Change: V727E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: V727E

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 55,026,645 (GRCm39) missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 55,036,090 (GRCm39) splice site probably benign
IGL01380:Sf3b1 APN 1 55,027,108 (GRCm39) missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 55,026,588 (GRCm39) missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55,046,866 (GRCm39) missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55,051,372 (GRCm39) missense probably benign
Colt UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
Glock UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
Handgun UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
Kalashnikov UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
Magazine UTSW 1 55,051,341 (GRCm39) nonsense probably null
Revolver UTSW 1 55,058,548 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0190:Sf3b1 UTSW 1 55,029,465 (GRCm39) missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 55,037,267 (GRCm39) missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55,058,430 (GRCm39) missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55,058,544 (GRCm39) missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55,042,313 (GRCm39) missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55,040,580 (GRCm39) missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55,058,536 (GRCm39) missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55,039,811 (GRCm39) missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 55,037,347 (GRCm39) missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55,046,792 (GRCm39) missense probably benign
R2429:Sf3b1 UTSW 1 55,055,960 (GRCm39) missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 55,038,785 (GRCm39) critical splice donor site probably null
R3772:Sf3b1 UTSW 1 55,039,150 (GRCm39) intron probably benign
R3911:Sf3b1 UTSW 1 55,058,548 (GRCm39) nonsense probably null
R3970:Sf3b1 UTSW 1 55,051,341 (GRCm39) nonsense probably null
R4706:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 55,038,871 (GRCm39) missense probably benign
R5053:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55,042,469 (GRCm39) missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55,042,309 (GRCm39) missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 55,037,334 (GRCm39) missense probably benign 0.27
R5636:Sf3b1 UTSW 1 55,036,352 (GRCm39) missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55,039,457 (GRCm39) missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55,046,677 (GRCm39) missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 55,038,814 (GRCm39) missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55,053,640 (GRCm39) critical splice donor site probably null
R7001:Sf3b1 UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
R7302:Sf3b1 UTSW 1 55,055,949 (GRCm39) missense probably benign 0.00
R7644:Sf3b1 UTSW 1 55,036,302 (GRCm39) nonsense probably null
R7664:Sf3b1 UTSW 1 55,026,626 (GRCm39) missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55,042,508 (GRCm39) missense probably benign 0.29
R7809:Sf3b1 UTSW 1 55,034,614 (GRCm39) missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55,051,262 (GRCm39) missense probably null 0.01
R8871:Sf3b1 UTSW 1 55,029,508 (GRCm39) missense probably damaging 1.00
R9216:Sf3b1 UTSW 1 55,051,376 (GRCm39) missense probably benign 0.00
Z1177:Sf3b1 UTSW 1 55,042,561 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATCCATAAGAGGAATAAGATACCC -3'
(R):5'- CACGCAAATTTTGAAATGGGGTTTG -3'

Sequencing Primer
(F):5'- GAGGAATAAGATACCCAATAGCCTTC -3'
(R):5'- TTTCTGTTAACAAATTACCATTGCC -3'
Posted On 2021-08-31