Incidental Mutation 'R8947:R3hdm1'
ID 681338
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene Name R3H domain containing 1
Synonyms
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 128031038-128165473 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128102694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 125 (M125K)
Ref Sequence ENSEMBL: ENSMUSP00000140538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000187023] [ENSMUST00000187900] [ENSMUST00000188381] [ENSMUST00000189317]
AlphaFold E9Q9Q2
Predicted Effect probably benign
Transcript: ENSMUST00000036288
AA Change: M169K

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: M169K

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185853
Predicted Effect probably benign
Transcript: ENSMUST00000187023
AA Change: M113K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139749
Gene: ENSMUSG00000056211
AA Change: M113K

DomainStartEndE-ValueType
R3H 95 172 1.9e-24 SMART
Pfam:SUZ 193 246 2.6e-11 PFAM
low complexity region 335 368 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187900
AA Change: M169K

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141142
Gene: ENSMUSG00000056211
AA Change: M169K

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 2.7e-14 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188381
AA Change: M125K

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140538
Gene: ENSMUSG00000056211
AA Change: M125K

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
R3H 107 184 3.18e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189317
AA Change: M155K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140175
Gene: ENSMUSG00000056211
AA Change: M155K

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
R3H 137 214 1.9e-24 SMART
Pfam:SUZ 235 287 2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128,164,176 (GRCm39) missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128,102,700 (GRCm39) missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128,163,369 (GRCm39) splice site probably benign
IGL00885:R3hdm1 APN 1 128,164,175 (GRCm39) missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128,089,933 (GRCm39) intron probably benign
IGL01137:R3hdm1 APN 1 128,109,612 (GRCm39) missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128,144,280 (GRCm39) missense probably benign
IGL01461:R3hdm1 APN 1 128,106,643 (GRCm39) missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128,114,553 (GRCm39) missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128,102,970 (GRCm39) critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128,114,497 (GRCm39) nonsense probably null
IGL01934:R3hdm1 APN 1 128,164,272 (GRCm39) missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128,096,775 (GRCm39) missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128,124,836 (GRCm39) critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128,118,456 (GRCm39) missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128,102,677 (GRCm39) splice site probably benign
driven UTSW 1 128,121,302 (GRCm39) missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128,138,929 (GRCm39) splice site probably benign
R0280:R3hdm1 UTSW 1 128,090,512 (GRCm39) missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128,112,254 (GRCm39) missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128,121,440 (GRCm39) missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128,159,174 (GRCm39) nonsense probably null
R0698:R3hdm1 UTSW 1 128,109,476 (GRCm39) missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128,109,476 (GRCm39) missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128,121,333 (GRCm39) missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128,124,742 (GRCm39) missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128,159,142 (GRCm39) missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128,159,142 (GRCm39) missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128,159,142 (GRCm39) missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128,124,742 (GRCm39) missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128,162,821 (GRCm39) missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128,096,753 (GRCm39) missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128,118,430 (GRCm39) missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128,114,573 (GRCm39) missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128,114,666 (GRCm39) intron probably benign
R4564:R3hdm1 UTSW 1 128,149,396 (GRCm39) missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128,102,975 (GRCm39) splice site probably benign
R4649:R3hdm1 UTSW 1 128,112,181 (GRCm39) missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128,112,181 (GRCm39) missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128,112,181 (GRCm39) missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128,112,181 (GRCm39) missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128,164,503 (GRCm39) utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128,159,084 (GRCm39) missense probably benign
R5554:R3hdm1 UTSW 1 128,164,409 (GRCm39) missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128,138,960 (GRCm39) missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128,096,773 (GRCm39) missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128,079,598 (GRCm39) missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128,121,302 (GRCm39) missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128,090,548 (GRCm39) frame shift probably null
R6639:R3hdm1 UTSW 1 128,090,548 (GRCm39) frame shift probably null
R6756:R3hdm1 UTSW 1 128,090,548 (GRCm39) frame shift probably null
R7168:R3hdm1 UTSW 1 128,144,232 (GRCm39) missense probably benign 0.05
R7210:R3hdm1 UTSW 1 128,138,945 (GRCm39) missense possibly damaging 0.95
R7367:R3hdm1 UTSW 1 128,081,129 (GRCm39) missense possibly damaging 0.64
R7536:R3hdm1 UTSW 1 128,109,948 (GRCm39) splice site probably null
R7896:R3hdm1 UTSW 1 128,096,703 (GRCm39) splice site probably null
R8391:R3hdm1 UTSW 1 128,121,215 (GRCm39) missense
R8486:R3hdm1 UTSW 1 128,106,657 (GRCm39) missense probably benign 0.11
R8490:R3hdm1 UTSW 1 128,162,864 (GRCm39) missense probably benign 0.26
R8990:R3hdm1 UTSW 1 128,106,833 (GRCm39) missense probably damaging 1.00
R9141:R3hdm1 UTSW 1 128,164,212 (GRCm39) missense probably damaging 1.00
R9195:R3hdm1 UTSW 1 128,089,975 (GRCm39) missense probably benign 0.28
R9426:R3hdm1 UTSW 1 128,164,212 (GRCm39) missense probably damaging 1.00
R9469:R3hdm1 UTSW 1 128,106,921 (GRCm39) critical splice donor site probably null
X0017:R3hdm1 UTSW 1 128,095,658 (GRCm39) missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128,096,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGTCCACAACTCTACTG -3'
(R):5'- CCTGTGGTAAGATGTCATCGGG -3'

Sequencing Primer
(F):5'- CTGTCCACAACTCTACTGTAAAAAG -3'
(R):5'- CATCGGGGGAAACTTCTTACG -3'
Posted On 2021-08-31