Incidental Mutation 'R0734:Erich6'
ID68134
Institutional Source Beutler Lab
Gene Symbol Erich6
Ensembl Gene ENSMUSG00000070471
Gene Nameglutamate rich 6
SynonymsFam194a, 4932431H17Rik
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0734 (G1)
Quality Score161
Status Validated
Chromosome3
Chromosomal Location58616300-58637207 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 58629388 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041115]
Predicted Effect probably benign
Transcript: ENSMUST00000041115
SMART Domains Protein: ENSMUSP00000040882
Gene: ENSMUSG00000070471

DomainStartEndE-ValueType
coiled coil region 27 77 N/A INTRINSIC
low complexity region 164 174 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
Pfam:FAM194 473 675 5.4e-67 PFAM
Meta Mutation Damage Score 0.1404 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Erich6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Erich6 APN 3 58637043 missense unknown
IGL01352:Erich6 APN 3 58622360 splice site probably null
IGL01362:Erich6 APN 3 58622360 splice site probably null
IGL01928:Erich6 APN 3 58621271 missense probably damaging 1.00
IGL02930:Erich6 APN 3 58622354 splice site probably benign
IGL03125:Erich6 APN 3 58624306 missense probably benign 0.00
PIT4243001:Erich6 UTSW 3 58629879 missense possibly damaging 0.51
R0081:Erich6 UTSW 3 58636126 splice site probably benign
R0129:Erich6 UTSW 3 58624378 missense probably damaging 1.00
R0308:Erich6 UTSW 3 58636104 missense probably damaging 1.00
R0682:Erich6 UTSW 3 58636811 missense probably benign 0.39
R0744:Erich6 UTSW 3 58636122 splice site probably benign
R0833:Erich6 UTSW 3 58618944 splice site probably benign
R0836:Erich6 UTSW 3 58618944 splice site probably benign
R1385:Erich6 UTSW 3 58636830 missense probably benign 0.00
R1536:Erich6 UTSW 3 58626598 missense probably benign 0.01
R1570:Erich6 UTSW 3 58630659 critical splice donor site probably null
R1708:Erich6 UTSW 3 58616447 missense probably benign 0.21
R2187:Erich6 UTSW 3 58629845 critical splice donor site probably null
R2268:Erich6 UTSW 3 58618839 missense probably benign 0.03
R2441:Erich6 UTSW 3 58618811 missense probably damaging 1.00
R3803:Erich6 UTSW 3 58621332 missense probably damaging 1.00
R3981:Erich6 UTSW 3 58636704 missense probably benign 0.41
R4166:Erich6 UTSW 3 58618808 missense probably damaging 1.00
R4298:Erich6 UTSW 3 58624291 missense probably benign 0.09
R4729:Erich6 UTSW 3 58636059 critical splice donor site probably null
R4838:Erich6 UTSW 3 58636830 missense probably benign 0.00
R5117:Erich6 UTSW 3 58623205 missense probably benign 0.00
R5305:Erich6 UTSW 3 58625116 missense probably benign 0.21
R5546:Erich6 UTSW 3 58618797 missense probably benign 0.39
R5605:Erich6 UTSW 3 58625119 missense probably damaging 1.00
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6378:Erich6 UTSW 3 58622359 splice site probably null
R6606:Erich6 UTSW 3 58616500 missense probably damaging 1.00
R6736:Erich6 UTSW 3 58625054 missense probably damaging 1.00
R6746:Erich6 UTSW 3 58616566 missense possibly damaging 0.69
R6974:Erich6 UTSW 3 58618799 missense probably benign 0.06
R6996:Erich6 UTSW 3 58636095 missense probably damaging 1.00
R7317:Erich6 UTSW 3 58636884 missense probably benign 0.26
R7526:Erich6 UTSW 3 58630689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATACCCAGATCCAGACTCGTAGC -3'
(R):5'- TGTACCCTGTCAAGCAGTGCAAG -3'

Sequencing Primer
(F):5'- GTAGCCTCCTAAACCATAGGGTAG -3'
(R):5'- ACACTGCAAAATGGTTTGCC -3'
Posted On2013-09-03