Mutagenetix > Incidental Mutation

Incidental Mutation 'R8947:Cacna1e'

681340

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

068785-MU

Accession Numbers

Genbank: NM_009782; MGI: 106217

Essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R8947 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 154402150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2019 (S2019T)

Ref Sequence

ENSEMBL: ENSMUSP00000148507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004214
AA Change: S1730T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: S1730T

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187541
AA Change: S2038T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: S2038T

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211821
AA Change: S2019T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,972,097	S477T	probably benign	Het
4930562C15Rik	T	A	16: 4,847,428	F141L	unknown	Het
A2ml1	G	T	6: 128,552,256	N974K	probably damaging	Het
Abcg8	T	C	17: 84,691,818	L114P	probably damaging	Het
Akt3	A	T	1: 177,131,079	W22R	probably damaging	Het
Ank2	C	T	3: 126,942,747		probably benign	Het
Ap1g1	C	T	8: 109,863,332		probably benign	Het
Arhgef19	T	A	4: 141,246,307	V35E	possibly damaging	Het
Baz2b	T	C	2: 59,948,239	D759G	probably benign	Het
BC051665	C	A	13: 60,782,190	G320W	probably damaging	Het
Bche	T	A	3: 73,701,428	T222S	probably damaging	Het
C8a	T	C	4: 104,822,129	D444G	probably damaging	Het
Carm1	T	C	9: 21,586,453	I373T	probably damaging	Het
Ccdc39	T	C	3: 33,815,460		probably benign	Het
Clic5	A	T	17: 44,242,261		probably benign	Het
Cntn3	A	G	6: 102,437,903	F28L	probably damaging	Het
Col6a5	C	T	9: 105,945,634	E175K	unknown	Het
Cpb2	T	C	14: 75,278,187	Y352H	probably damaging	Het
Cpeb3	A	T	19: 37,174,966	D3E	probably damaging	Het
Ctsl	T	C	13: 64,367,026	T155A	probably damaging	Het
Cygb	C	T	11: 116,649,819	A114T	probably damaging	Het
Cyp11a1	T	C	9: 58,017,455	V17A	probably benign	Het
Dhcr7	T	G	7: 143,847,222	I374S	probably damaging	Het
Dhx36	T	C	3: 62,472,966	R807G	probably benign	Het
Diaph1	A	T	18: 37,853,701	V1077E	probably damaging	Het
Ehmt2	A	G	17: 34,908,304	E131G	possibly damaging	Het
Evpl	A	G	11: 116,221,338	I1842T	probably damaging	Het
Fastk	C	A	5: 24,441,651	C294F	probably damaging	Het
Fndc5	T	C	4: 129,137,136	C20R	probably benign	Het
Gm7298	C	A	6: 121,780,594	Q1053K	possibly damaging	Het
Gm8362	A	G	14: 6,773,326		probably null	Het
Gmps	T	A	3: 63,998,677	I465N	probably damaging	Het
Heatr4	T	G	12: 83,954,657	M904L	probably benign	Het
Hhip	T	A	8: 80,045,156	D175V	probably damaging	Het
Hmcn2	G	A	2: 31,388,208	V1641M	probably damaging	Het
Hoxa5	T	G	6: 52,202,796	T200P	probably damaging	Het
Ift122	C	A	6: 115,924,407	A1050D	probably benign	Het
Igf2bp2	C	A	16: 22,078,723	E247*	probably null	Het
Irak1bp1	T	A	9: 82,846,793	L259H	probably damaging	Het
Irgm1	G	A	11: 48,868,748		probably benign	Het
Itih1	A	T	14: 30,935,909		probably benign	Het
Itpk1	A	T	12: 102,570,323	C355S	probably benign	Het
Kcng4	T	C	8: 119,625,713	E486G	possibly damaging	Het
Kif20b	T	C	19: 34,941,229	V671A	possibly damaging	Het
Kif28	T	G	1: 179,716,755	I345L	possibly damaging	Het
Klri2	C	G	6: 129,733,779		probably null	Het
Kntc1	T	C	5: 123,786,978	V1118A	probably benign	Het
Lpin2	T	A	17: 71,204,876	I34N	probably benign	Het
Lrch3	T	A	16: 32,981,829	V264D	possibly damaging	Het
Lrrk2	C	T	15: 91,702,270	Q430*	probably null	Het
Map10	T	G	8: 125,671,100	S411A	probably benign	Het
Map1a	A	T	2: 121,304,969	I2089F	probably benign	Het
Med12l	T	A	3: 59,077,022		probably benign	Het
Mypn	T	A	10: 63,169,377	Q317L	probably damaging	Het
Ncan	T	A	8: 70,102,521	I999F	probably damaging	Het
Nmrk2	C	A	10: 81,199,705	R134L	probably damaging	Het
Olfr1290	C	T	2: 111,489,697	V154I	probably benign	Het
Olfr181	T	C	16: 58,926,070	N167S	probably benign	Het
Olfr5	A	G	7: 6,480,247	V303A	probably benign	Het
Olfr583	T	A	7: 103,052,108	V270E	probably damaging	Het
Olfr905	T	A	9: 38,473,389	I214N	probably damaging	Het
Osbpl1a	A	G	18: 12,766,801		probably null	Het
Pcdh1	T	C	18: 38,199,020	D310G	possibly damaging	Het
Pkn2	C	T	3: 142,811,913		probably null	Het
Plch1	T	A	3: 63,784,126	M31L	probably damaging	Het
Polg2	A	G	11: 106,768,344	F448L	probably damaging	Het
Ppp4r3b	A	G	11: 29,200,758	T475A	possibly damaging	Het
Prdm13	C	T	4: 21,678,817	E558K	probably damaging	Het
Prdm9	T	A	17: 15,544,008	I837F	possibly damaging	Het
R3hdm1	T	A	1: 128,174,957	M125K	possibly damaging	Het
Rbm39	A	T	2: 156,148,356	V468E	probably damaging	Het
Rnasel	T	A	1: 153,755,031	V431E	probably damaging	Het
Rps2	T	A	17: 24,721,253	D220E	probably benign	Het
Rsf1	T	C	7: 97,681,852		probably benign	Het
Rsph10b	G	T	5: 143,977,134	A710S	probably benign	Het
Sez6	A	T	11: 77,953,527	T59S	probably damaging	Het
Sf3b1	A	T	1: 55,000,285	V727E	probably damaging	Het
Slit2	T	G	5: 48,249,798	L857R	probably damaging	Het
Sspo	T	G	6: 48,448,570	C42G	probably damaging	Het
Strc	C	T	2: 121,370,989	D1245N	probably benign	Het
Supv3l1	T	A	10: 62,432,339	T576S	probably benign	Het
Tecrl	C	T	5: 83,313,307	R101Q	probably benign	Het
Tmeff2	A	G	1: 51,181,793	Y309C	probably damaging	Het
Tmem43	T	A	6: 91,485,380	W316R	probably damaging	Het
Tmigd3	T	C	3: 105,914,238	V141A	probably benign	Het
Trav9-1	T	C	14: 53,488,127	F8L	probably benign	Het
Trbv5	T	G	6: 41,062,707	F82C	probably damaging	Het
Ubtf	T	C	11: 102,314,976	N41S	possibly damaging	Het
Uggt1	T	C	1: 36,158,148	T1225A	probably benign	Het
Vmn1r72	T	C	7: 11,669,880	R214G	possibly damaging	Het
Vmn2r12	T	G	5: 109,086,656	K563N	possibly damaging	Het
Vmn2r83	T	C	10: 79,469,039	S28P	probably benign	Het
Vwa8	T	G	14: 79,201,112	L1875R	probably damaging	Het
Xrcc6	T	A	15: 82,029,665	V64E	probably damaging	Het
Zfp292	T	C	4: 34,811,835	Y403C	probably damaging	Het
Zfp955a	A	T	17: 33,241,981	H392Q	probably damaging	Het
Zfyve19	T	C	2: 119,210,809	S69P	probably damaging	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154485662	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154561758	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R4979:Cacna1e	UTSW	1	154413993	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154437323	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154561770	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154473886	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154701334	missense	possibly damaging	0.84
R9094:Cacna1e	UTSW	1	154479318	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154467764	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154413099	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154485712	missense	possibly damaging	0.88
R9452:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R9463:Cacna1e	UTSW	1	154481665	missense	probably damaging	1.00
R9513:Cacna1e	UTSW	1	154442287	missense	probably damaging	1.00
R9534:Cacna1e	UTSW	1	154444947	missense	possibly damaging	0.65
R9562:Cacna1e	UTSW	1	154407740	missense	probably benign	0.01
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGCTAGAGGCTCAACTTC -3'
(R):5'- TTGATCTGCCTGGAGAAGCC -3'

Sequencing Primer
(F):5'- AGAGGCTCAACTTCTCTATATTCAC -3'
(R):5'- AGGGCACTTCAGTCAGTTCAG -3'

Posted On

2021-08-31