Incidental Mutation 'R8947:Strc'
ID 681348
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Name stereocilin
Synonyms DFNB16
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121193729-121211851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121201470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1245 (D1245N)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably benign
Transcript: ENSMUST00000038389
AA Change: D1245N

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D1245N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121,195,541 (GRCm39) missense probably benign 0.39
IGL01152:Strc APN 2 121,201,276 (GRCm39) missense probably benign
IGL01608:Strc APN 2 121,206,075 (GRCm39) missense probably benign 0.05
IGL01695:Strc APN 2 121,205,779 (GRCm39) missense probably damaging 1.00
IGL01715:Strc APN 2 121,196,218 (GRCm39) splice site probably null
IGL01906:Strc APN 2 121,208,115 (GRCm39) missense probably benign
IGL02135:Strc APN 2 121,195,315 (GRCm39) missense probably damaging 1.00
IGL02416:Strc APN 2 121,199,539 (GRCm39) missense probably damaging 1.00
IGL02455:Strc APN 2 121,206,272 (GRCm39) unclassified probably benign
IGL03029:Strc APN 2 121,194,525 (GRCm39) missense possibly damaging 0.95
IGL03176:Strc APN 2 121,202,661 (GRCm39) missense probably damaging 0.99
IGL03272:Strc APN 2 121,202,232 (GRCm39) missense probably damaging 1.00
3-1:Strc UTSW 2 121,204,161 (GRCm39) missense probably damaging 0.99
IGL02799:Strc UTSW 2 121,209,717 (GRCm39) missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121,205,788 (GRCm39) missense probably damaging 1.00
R0022:Strc UTSW 2 121,198,874 (GRCm39) missense probably damaging 1.00
R0494:Strc UTSW 2 121,210,014 (GRCm39) missense probably damaging 0.99
R1065:Strc UTSW 2 121,197,132 (GRCm39) missense probably damaging 1.00
R1148:Strc UTSW 2 121,202,558 (GRCm39) intron probably benign
R1148:Strc UTSW 2 121,202,558 (GRCm39) intron probably benign
R1203:Strc UTSW 2 121,202,604 (GRCm39) missense possibly damaging 0.66
R1343:Strc UTSW 2 121,195,596 (GRCm39) missense probably benign 0.21
R1544:Strc UTSW 2 121,203,219 (GRCm39) splice site probably null
R1650:Strc UTSW 2 121,211,366 (GRCm39) start gained probably benign
R1840:Strc UTSW 2 121,209,777 (GRCm39) missense probably damaging 1.00
R1983:Strc UTSW 2 121,201,518 (GRCm39) missense possibly damaging 0.54
R2035:Strc UTSW 2 121,205,415 (GRCm39) missense probably damaging 1.00
R2058:Strc UTSW 2 121,209,368 (GRCm39) missense probably damaging 1.00
R2158:Strc UTSW 2 121,196,343 (GRCm39) missense probably benign 0.10
R2219:Strc UTSW 2 121,195,004 (GRCm39) missense probably damaging 1.00
R2680:Strc UTSW 2 121,195,592 (GRCm39) missense probably damaging 0.99
R4375:Strc UTSW 2 121,211,304 (GRCm39) missense unknown
R4563:Strc UTSW 2 121,196,286 (GRCm39) missense probably benign 0.02
R4578:Strc UTSW 2 121,208,484 (GRCm39) missense possibly damaging 0.94
R4607:Strc UTSW 2 121,203,426 (GRCm39) missense probably benign 0.31
R4651:Strc UTSW 2 121,204,829 (GRCm39) missense possibly damaging 0.67
R4652:Strc UTSW 2 121,204,829 (GRCm39) missense possibly damaging 0.67
R4790:Strc UTSW 2 121,206,075 (GRCm39) missense probably benign 0.05
R5480:Strc UTSW 2 121,195,300 (GRCm39) missense probably benign 0.00
R5580:Strc UTSW 2 121,205,493 (GRCm39) missense probably damaging 0.99
R5679:Strc UTSW 2 121,198,581 (GRCm39) missense probably benign 0.03
R5703:Strc UTSW 2 121,201,295 (GRCm39) missense probably benign
R5841:Strc UTSW 2 121,196,358 (GRCm39) missense probably benign 0.29
R5917:Strc UTSW 2 121,209,790 (GRCm39) missense probably benign
R5958:Strc UTSW 2 121,207,403 (GRCm39) missense possibly damaging 0.56
R6320:Strc UTSW 2 121,205,439 (GRCm39) missense probably benign 0.16
R6619:Strc UTSW 2 121,198,913 (GRCm39) missense probably damaging 0.99
R6695:Strc UTSW 2 121,207,705 (GRCm39) missense probably benign 0.35
R6970:Strc UTSW 2 121,208,495 (GRCm39) missense probably benign 0.41
R7018:Strc UTSW 2 121,199,539 (GRCm39) missense probably damaging 1.00
R7045:Strc UTSW 2 121,201,207 (GRCm39) missense probably damaging 1.00
R7190:Strc UTSW 2 121,199,507 (GRCm39) missense probably benign 0.14
R7283:Strc UTSW 2 121,209,933 (GRCm39) missense probably damaging 0.99
R7694:Strc UTSW 2 121,207,577 (GRCm39) missense probably damaging 1.00
R7699:Strc UTSW 2 121,202,229 (GRCm39) missense possibly damaging 0.47
R7700:Strc UTSW 2 121,202,229 (GRCm39) missense possibly damaging 0.47
R7756:Strc UTSW 2 121,201,427 (GRCm39) missense probably benign
R7758:Strc UTSW 2 121,201,427 (GRCm39) missense probably benign
R7822:Strc UTSW 2 121,208,219 (GRCm39) missense probably benign 0.01
R7830:Strc UTSW 2 121,205,530 (GRCm39) missense probably damaging 0.99
R7953:Strc UTSW 2 121,207,844 (GRCm39) missense probably damaging 0.99
R8137:Strc UTSW 2 121,197,219 (GRCm39) missense probably damaging 0.98
R8394:Strc UTSW 2 121,209,490 (GRCm39) missense probably benign 0.00
R8427:Strc UTSW 2 121,208,012 (GRCm39) missense probably damaging 1.00
R8792:Strc UTSW 2 121,208,286 (GRCm39) missense probably damaging 0.99
R8874:Strc UTSW 2 121,205,353 (GRCm39) critical splice donor site probably null
R9285:Strc UTSW 2 121,195,279 (GRCm39) missense probably damaging 1.00
R9302:Strc UTSW 2 121,211,336 (GRCm39) missense unknown
R9386:Strc UTSW 2 121,198,211 (GRCm39) missense probably damaging 0.99
R9438:Strc UTSW 2 121,198,647 (GRCm39) missense probably damaging 1.00
R9581:Strc UTSW 2 121,207,928 (GRCm39) missense probably damaging 0.99
Z1176:Strc UTSW 2 121,209,525 (GRCm39) missense probably damaging 1.00
Z1176:Strc UTSW 2 121,206,002 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCTCTGGCATTGTCATCC -3'
(R):5'- TCACAAGCTGTAGACGACTATC -3'

Sequencing Primer
(F):5'- CTGTAGCTCTGTCCAGATACAGG -3'
(R):5'- CTGTAGACGACTATCAGTGAGCATC -3'
Posted On 2021-08-31