Incidental Mutation 'R8947:Strc'
ID681348
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R8947 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121370989 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1245 (D1245N)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably benign
Transcript: ENSMUST00000038389
AA Change: D1245N

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D1245N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,097 S477T probably benign Het
4930562C15Rik T A 16: 4,847,428 F141L unknown Het
A2ml1 G T 6: 128,552,256 N974K probably damaging Het
Abcg8 T C 17: 84,691,818 L114P probably damaging Het
Akt3 A T 1: 177,131,079 W22R probably damaging Het
Ank2 C T 3: 126,942,747 probably benign Het
Ap1g1 C T 8: 109,863,332 probably benign Het
Arhgef19 T A 4: 141,246,307 V35E possibly damaging Het
Baz2b T C 2: 59,948,239 D759G probably benign Het
BC051665 C A 13: 60,782,190 G320W probably damaging Het
Bche T A 3: 73,701,428 T222S probably damaging Het
C8a T C 4: 104,822,129 D444G probably damaging Het
Cacna1e A T 1: 154,402,150 S2019T probably benign Het
Carm1 T C 9: 21,586,453 I373T probably damaging Het
Cntn3 A G 6: 102,437,903 F28L probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Cpb2 T C 14: 75,278,187 Y352H probably damaging Het
Cpeb3 A T 19: 37,174,966 D3E probably damaging Het
Ctsl T C 13: 64,367,026 T155A probably damaging Het
Cygb C T 11: 116,649,819 A114T probably damaging Het
Cyp11a1 T C 9: 58,017,455 V17A probably benign Het
Dhcr7 T G 7: 143,847,222 I374S probably damaging Het
Dhx36 T C 3: 62,472,966 R807G probably benign Het
Diaph1 A T 18: 37,853,701 V1077E probably damaging Het
Evpl A G 11: 116,221,338 I1842T probably damaging Het
Fastk C A 5: 24,441,651 C294F probably damaging Het
Fndc5 T C 4: 129,137,136 C20R probably benign Het
Gm7298 C A 6: 121,780,594 Q1053K possibly damaging Het
Gm8362 A G 14: 6,773,326 probably null Het
Gmps T A 3: 63,998,677 I465N probably damaging Het
Heatr4 T G 12: 83,954,657 M904L probably benign Het
Hhip T A 8: 80,045,156 D175V probably damaging Het
Hmcn2 G A 2: 31,388,208 V1641M probably damaging Het
Hoxa5 T G 6: 52,202,796 T200P probably damaging Het
Ift122 C A 6: 115,924,407 A1050D probably benign Het
Igf2bp2 C A 16: 22,078,723 E247* probably null Het
Irak1bp1 T A 9: 82,846,793 L259H probably damaging Het
Irgm1 G A 11: 48,868,748 probably benign Het
Itpk1 A T 12: 102,570,323 C355S probably benign Het
Kcng4 T C 8: 119,625,713 E486G possibly damaging Het
Kif20b T C 19: 34,941,229 V671A possibly damaging Het
Kif28 T G 1: 179,716,755 I345L possibly damaging Het
Klri2 C G 6: 129,733,779 probably null Het
Kntc1 T C 5: 123,786,978 V1118A probably benign Het
Lpin2 T A 17: 71,204,876 I34N probably benign Het
Lrch3 T A 16: 32,981,829 V264D possibly damaging Het
Lrrk2 C T 15: 91,702,270 Q430* probably null Het
Map10 T G 8: 125,671,100 S411A probably benign Het
Map1a A T 2: 121,304,969 I2089F probably benign Het
Mypn T A 10: 63,169,377 Q317L probably damaging Het
Ncan T A 8: 70,102,521 I999F probably damaging Het
Nmrk2 C A 10: 81,199,705 R134L probably damaging Het
Olfr1290 C T 2: 111,489,697 V154I probably benign Het
Olfr181 T C 16: 58,926,070 N167S probably benign Het
Olfr5 A G 7: 6,480,247 V303A probably benign Het
Olfr583 T A 7: 103,052,108 V270E probably damaging Het
Olfr905 T A 9: 38,473,389 I214N probably damaging Het
Osbpl1a A G 18: 12,766,801 probably null Het
Pcdh1 T C 18: 38,199,020 D310G possibly damaging Het
Pkn2 C T 3: 142,811,913 probably null Het
Plch1 T A 3: 63,784,126 M31L probably damaging Het
Polg2 A G 11: 106,768,344 F448L probably damaging Het
Ppp4r3b A G 11: 29,200,758 T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 E558K probably damaging Het
Prdm9 T A 17: 15,544,008 I837F possibly damaging Het
R3hdm1 T A 1: 128,174,957 M125K possibly damaging Het
Rbm39 A T 2: 156,148,356 V468E probably damaging Het
Rnasel T A 1: 153,755,031 V431E probably damaging Het
Rps2 T A 17: 24,721,253 D220E probably benign Het
Rsf1 T C 7: 97,681,852 probably benign Het
Rsph10b G T 5: 143,977,134 A710S probably benign Het
Sez6 A T 11: 77,953,527 T59S probably damaging Het
Sf3b1 A T 1: 55,000,285 V727E probably damaging Het
Slit2 T G 5: 48,249,798 L857R probably damaging Het
Sspo T G 6: 48,448,570 C42G probably damaging Het
Supv3l1 T A 10: 62,432,339 T576S probably benign Het
Tecrl C T 5: 83,313,307 R101Q probably benign Het
Tmeff2 A G 1: 51,181,793 Y309C probably damaging Het
Tmem43 T A 6: 91,485,380 W316R probably damaging Het
Tmigd3 T C 3: 105,914,238 V141A probably benign Het
Trav9-1 T C 14: 53,488,127 F8L probably benign Het
Trbv5 T G 6: 41,062,707 F82C probably damaging Het
Ubtf T C 11: 102,314,976 N41S possibly damaging Het
Uggt1 T C 1: 36,158,148 T1225A probably benign Het
Vmn1r72 T C 7: 11,669,880 R214G possibly damaging Het
Vmn2r12 T G 5: 109,086,656 K563N possibly damaging Het
Vmn2r83 T C 10: 79,469,039 S28P probably benign Het
Vwa8 T G 14: 79,201,112 L1875R probably damaging Het
Xrcc6 T A 15: 82,029,665 V64E probably damaging Het
Zfp292 T C 4: 34,811,835 Y403C probably damaging Het
Zfp955a A T 17: 33,241,981 H392Q probably damaging Het
Zfyve19 T C 2: 119,210,809 S69P probably damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
R8792:Strc UTSW 2 121377805 missense probably damaging 0.99
R8874:Strc UTSW 2 121374872 critical splice donor site probably null
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTGGCATTGTCATCC -3'
(R):5'- TCACAAGCTGTAGACGACTATC -3'

Sequencing Primer
(F):5'- CTGTAGCTCTGTCCAGATACAGG -3'
(R):5'- CTGTAGACGACTATCAGTGAGCATC -3'
Posted On2021-08-31