Mutagenetix > Incidental Mutation

Incidental Mutation 'R8947:Strc'

681348

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R8947 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121370989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1245 (D1245N)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: D1245N

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D1245N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,972,097	S477T	probably benign	Het
4930562C15Rik	T	A	16: 4,847,428	F141L	unknown	Het
A2ml1	G	T	6: 128,552,256	N974K	probably damaging	Het
Abcg8	T	C	17: 84,691,818	L114P	probably damaging	Het
Akt3	A	T	1: 177,131,079	W22R	probably damaging	Het
Ank2	C	T	3: 126,942,747		probably benign	Het
Ap1g1	C	T	8: 109,863,332		probably benign	Het
Arhgef19	T	A	4: 141,246,307	V35E	possibly damaging	Het
Baz2b	T	C	2: 59,948,239	D759G	probably benign	Het
BC051665	C	A	13: 60,782,190	G320W	probably damaging	Het
Bche	T	A	3: 73,701,428	T222S	probably damaging	Het
C8a	T	C	4: 104,822,129	D444G	probably damaging	Het
Cacna1e	A	T	1: 154,402,150	S2019T	probably benign	Het
Carm1	T	C	9: 21,586,453	I373T	probably damaging	Het
Ccdc39	T	C	3: 33,815,460		probably benign	Het
Clic5	A	T	17: 44,242,261		probably benign	Het
Cntn3	A	G	6: 102,437,903	F28L	probably damaging	Het
Col6a5	C	T	9: 105,945,634	E175K	unknown	Het
Cpb2	T	C	14: 75,278,187	Y352H	probably damaging	Het
Cpeb3	A	T	19: 37,174,966	D3E	probably damaging	Het
Ctsl	T	C	13: 64,367,026	T155A	probably damaging	Het
Cygb	C	T	11: 116,649,819	A114T	probably damaging	Het
Cyp11a1	T	C	9: 58,017,455	V17A	probably benign	Het
Dhcr7	T	G	7: 143,847,222	I374S	probably damaging	Het
Dhx36	T	C	3: 62,472,966	R807G	probably benign	Het
Diaph1	A	T	18: 37,853,701	V1077E	probably damaging	Het
Ehmt2	A	G	17: 34,908,304	E131G	possibly damaging	Het
Evpl	A	G	11: 116,221,338	I1842T	probably damaging	Het
Fastk	C	A	5: 24,441,651	C294F	probably damaging	Het
Fndc5	T	C	4: 129,137,136	C20R	probably benign	Het
Gm7298	C	A	6: 121,780,594	Q1053K	possibly damaging	Het
Gm8362	A	G	14: 6,773,326		probably null	Het
Gmps	T	A	3: 63,998,677	I465N	probably damaging	Het
Heatr4	T	G	12: 83,954,657	M904L	probably benign	Het
Hhip	T	A	8: 80,045,156	D175V	probably damaging	Het
Hmcn2	G	A	2: 31,388,208	V1641M	probably damaging	Het
Hoxa5	T	G	6: 52,202,796	T200P	probably damaging	Het
Ift122	C	A	6: 115,924,407	A1050D	probably benign	Het
Igf2bp2	C	A	16: 22,078,723	E247*	probably null	Het
Irak1bp1	T	A	9: 82,846,793	L259H	probably damaging	Het
Irgm1	G	A	11: 48,868,748		probably benign	Het
Itih1	A	T	14: 30,935,909		probably benign	Het
Itpk1	A	T	12: 102,570,323	C355S	probably benign	Het
Kcng4	T	C	8: 119,625,713	E486G	possibly damaging	Het
Kif20b	T	C	19: 34,941,229	V671A	possibly damaging	Het
Kif28	T	G	1: 179,716,755	I345L	possibly damaging	Het
Klri2	C	G	6: 129,733,779		probably null	Het
Kntc1	T	C	5: 123,786,978	V1118A	probably benign	Het
Lpin2	T	A	17: 71,204,876	I34N	probably benign	Het
Lrch3	T	A	16: 32,981,829	V264D	possibly damaging	Het
Lrrk2	C	T	15: 91,702,270	Q430*	probably null	Het
Map10	T	G	8: 125,671,100	S411A	probably benign	Het
Map1a	A	T	2: 121,304,969	I2089F	probably benign	Het
Med12l	T	A	3: 59,077,022		probably benign	Het
Mypn	T	A	10: 63,169,377	Q317L	probably damaging	Het
Ncan	T	A	8: 70,102,521	I999F	probably damaging	Het
Nmrk2	C	A	10: 81,199,705	R134L	probably damaging	Het
Olfr1290	C	T	2: 111,489,697	V154I	probably benign	Het
Olfr181	T	C	16: 58,926,070	N167S	probably benign	Het
Olfr5	A	G	7: 6,480,247	V303A	probably benign	Het
Olfr583	T	A	7: 103,052,108	V270E	probably damaging	Het
Olfr905	T	A	9: 38,473,389	I214N	probably damaging	Het
Osbpl1a	A	G	18: 12,766,801		probably null	Het
Pcdh1	T	C	18: 38,199,020	D310G	possibly damaging	Het
Pkn2	C	T	3: 142,811,913		probably null	Het
Plch1	T	A	3: 63,784,126	M31L	probably damaging	Het
Polg2	A	G	11: 106,768,344	F448L	probably damaging	Het
Ppp4r3b	A	G	11: 29,200,758	T475A	possibly damaging	Het
Prdm13	C	T	4: 21,678,817	E558K	probably damaging	Het
Prdm9	T	A	17: 15,544,008	I837F	possibly damaging	Het
R3hdm1	T	A	1: 128,174,957	M125K	possibly damaging	Het
Rbm39	A	T	2: 156,148,356	V468E	probably damaging	Het
Rnasel	T	A	1: 153,755,031	V431E	probably damaging	Het
Rps2	T	A	17: 24,721,253	D220E	probably benign	Het
Rsf1	T	C	7: 97,681,852		probably benign	Het
Rsph10b	G	T	5: 143,977,134	A710S	probably benign	Het
Sez6	A	T	11: 77,953,527	T59S	probably damaging	Het
Sf3b1	A	T	1: 55,000,285	V727E	probably damaging	Het
Slit2	T	G	5: 48,249,798	L857R	probably damaging	Het
Sspo	T	G	6: 48,448,570	C42G	probably damaging	Het
Supv3l1	T	A	10: 62,432,339	T576S	probably benign	Het
Tecrl	C	T	5: 83,313,307	R101Q	probably benign	Het
Tmeff2	A	G	1: 51,181,793	Y309C	probably damaging	Het
Tmem43	T	A	6: 91,485,380	W316R	probably damaging	Het
Tmigd3	T	C	3: 105,914,238	V141A	probably benign	Het
Trav9-1	T	C	14: 53,488,127	F8L	probably benign	Het
Trbv5	T	G	6: 41,062,707	F82C	probably damaging	Het
Ubtf	T	C	11: 102,314,976	N41S	possibly damaging	Het
Uggt1	T	C	1: 36,158,148	T1225A	probably benign	Het
Vmn1r72	T	C	7: 11,669,880	R214G	possibly damaging	Het
Vmn2r12	T	G	5: 109,086,656	K563N	possibly damaging	Het
Vmn2r83	T	C	10: 79,469,039	S28P	probably benign	Het
Vwa8	T	G	14: 79,201,112	L1875R	probably damaging	Het
Xrcc6	T	A	15: 82,029,665	V64E	probably damaging	Het
Zfp292	T	C	4: 34,811,835	Y403C	probably damaging	Het
Zfp955a	A	T	17: 33,241,981	H392Q	probably damaging	Het
Zfyve19	T	C	2: 119,210,809	S69P	probably damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGCTCTGGCATTGTCATCC -3'
(R):5'- TCACAAGCTGTAGACGACTATC -3'

Sequencing Primer
(F):5'- CTGTAGCTCTGTCCAGATACAGG -3'
(R):5'- CTGTAGACGACTATCAGTGAGCATC -3'

Posted On

2021-08-31