Incidental Mutation 'R8947:Vmn2r12'
ID 681366
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Name vomeronasal 2, receptor 12
Synonyms Gm6769
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109233715-109245730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 109234522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 563 (K563N)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
AlphaFold L7N217
Predicted Effect possibly damaging
Transcript: ENSMUST00000095922
AA Change: K563N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: K563N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109,245,541 (GRCm39) missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109,234,125 (GRCm39) missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109,239,716 (GRCm39) missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109,240,893 (GRCm39) nonsense probably null
IGL01762:Vmn2r12 APN 5 109,234,430 (GRCm39) missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109,240,025 (GRCm39) missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109,234,343 (GRCm39) missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109,233,858 (GRCm39) missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109,238,351 (GRCm39) missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109,239,936 (GRCm39) missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109,240,765 (GRCm39) missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109,239,755 (GRCm39) nonsense probably null
R0529:Vmn2r12 UTSW 5 109,240,714 (GRCm39) missense probably benign
R0715:Vmn2r12 UTSW 5 109,238,373 (GRCm39) missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109,234,281 (GRCm39) missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109,235,716 (GRCm39) critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109,239,763 (GRCm39) missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109,240,840 (GRCm39) missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109,240,696 (GRCm39) missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109,239,910 (GRCm39) missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109,239,594 (GRCm39) missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109,239,942 (GRCm39) missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109,239,340 (GRCm39) missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109,238,370 (GRCm39) missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109,239,412 (GRCm39) missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109,234,301 (GRCm39) missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109,234,379 (GRCm39) missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109,240,852 (GRCm39) missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109,239,544 (GRCm39) missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109,239,372 (GRCm39) missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109,238,261 (GRCm39) missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109,239,684 (GRCm39) missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109,234,483 (GRCm39) nonsense probably null
R5639:Vmn2r12 UTSW 5 109,240,666 (GRCm39) missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109,239,670 (GRCm39) missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109,233,736 (GRCm39) nonsense probably null
R6142:Vmn2r12 UTSW 5 109,240,763 (GRCm39) missense probably benign
R6162:Vmn2r12 UTSW 5 109,234,430 (GRCm39) missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109,233,866 (GRCm39) missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109,240,771 (GRCm39) missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109,245,655 (GRCm39) missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109,239,811 (GRCm39) missense possibly damaging 0.95
R7341:Vmn2r12 UTSW 5 109,234,113 (GRCm39) missense possibly damaging 0.74
R7383:Vmn2r12 UTSW 5 109,240,684 (GRCm39) missense probably benign 0.19
R7740:Vmn2r12 UTSW 5 109,239,615 (GRCm39) missense probably damaging 1.00
R7749:Vmn2r12 UTSW 5 109,233,920 (GRCm39) missense probably damaging 0.99
R7861:Vmn2r12 UTSW 5 109,235,829 (GRCm39) missense probably benign 0.00
R7908:Vmn2r12 UTSW 5 109,234,307 (GRCm39) missense probably damaging 1.00
R8128:Vmn2r12 UTSW 5 109,239,747 (GRCm39) missense possibly damaging 0.81
R8175:Vmn2r12 UTSW 5 109,238,349 (GRCm39) missense probably damaging 0.97
R8234:Vmn2r12 UTSW 5 109,234,074 (GRCm39) missense probably benign 0.01
R8771:Vmn2r12 UTSW 5 109,239,952 (GRCm39) missense possibly damaging 0.95
R8991:Vmn2r12 UTSW 5 109,234,033 (GRCm39) nonsense probably null
R9116:Vmn2r12 UTSW 5 109,233,885 (GRCm39) missense probably damaging 1.00
R9122:Vmn2r12 UTSW 5 109,240,910 (GRCm39) missense probably benign 0.00
R9153:Vmn2r12 UTSW 5 109,234,203 (GRCm39) missense probably damaging 1.00
R9371:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R9375:Vmn2r12 UTSW 5 109,233,986 (GRCm39) missense probably damaging 1.00
R9524:Vmn2r12 UTSW 5 109,239,823 (GRCm39) missense probably damaging 1.00
R9587:Vmn2r12 UTSW 5 109,239,322 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r12 UTSW 5 109,240,646 (GRCm39) missense probably benign
Z1176:Vmn2r12 UTSW 5 109,239,303 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGAATGCGGTTATTGGCC -3'
(R):5'- TGTTTTGTCCCATCACAAAGCATAG -3'

Sequencing Primer
(F):5'- ATTGGCCTTCACAATGGGAGTATCC -3'
(R):5'- GAGAACAACTTAAGTTAGTGGTCCC -3'
Posted On 2021-08-31