Incidental Mutation 'R8947:Ift122'
ID 681374
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115924407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 1050 (A1050D)
Ref Sequence ENSEMBL: ENSMUSP00000108547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably benign
Transcript: ENSMUST00000038234
AA Change: A1051D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: A1051D

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: A1109D

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
AA Change: A1050D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: A1050D

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,097 S477T probably benign Het
4930562C15Rik T A 16: 4,847,428 F141L unknown Het
A2ml1 G T 6: 128,552,256 N974K probably damaging Het
Abcg8 T C 17: 84,691,818 L114P probably damaging Het
Akt3 A T 1: 177,131,079 W22R probably damaging Het
Ank2 C T 3: 126,942,747 probably benign Het
Ap1g1 C T 8: 109,863,332 probably benign Het
Arhgef19 T A 4: 141,246,307 V35E possibly damaging Het
Baz2b T C 2: 59,948,239 D759G probably benign Het
BC051665 C A 13: 60,782,190 G320W probably damaging Het
Bche T A 3: 73,701,428 T222S probably damaging Het
C8a T C 4: 104,822,129 D444G probably damaging Het
Cacna1e A T 1: 154,402,150 S2019T probably benign Het
Carm1 T C 9: 21,586,453 I373T probably damaging Het
Cntn3 A G 6: 102,437,903 F28L probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Cpb2 T C 14: 75,278,187 Y352H probably damaging Het
Cpeb3 A T 19: 37,174,966 D3E probably damaging Het
Ctsl T C 13: 64,367,026 T155A probably damaging Het
Cygb C T 11: 116,649,819 A114T probably damaging Het
Cyp11a1 T C 9: 58,017,455 V17A probably benign Het
Dhcr7 T G 7: 143,847,222 I374S probably damaging Het
Dhx36 T C 3: 62,472,966 R807G probably benign Het
Diaph1 A T 18: 37,853,701 V1077E probably damaging Het
Evpl A G 11: 116,221,338 I1842T probably damaging Het
Fastk C A 5: 24,441,651 C294F probably damaging Het
Fndc5 T C 4: 129,137,136 C20R probably benign Het
Gm7298 C A 6: 121,780,594 Q1053K possibly damaging Het
Gm8362 A G 14: 6,773,326 probably null Het
Gmps T A 3: 63,998,677 I465N probably damaging Het
Heatr4 T G 12: 83,954,657 M904L probably benign Het
Hhip T A 8: 80,045,156 D175V probably damaging Het
Hmcn2 G A 2: 31,388,208 V1641M probably damaging Het
Hoxa5 T G 6: 52,202,796 T200P probably damaging Het
Igf2bp2 C A 16: 22,078,723 E247* probably null Het
Irak1bp1 T A 9: 82,846,793 L259H probably damaging Het
Irgm1 G A 11: 48,868,748 probably benign Het
Itpk1 A T 12: 102,570,323 C355S probably benign Het
Kcng4 T C 8: 119,625,713 E486G possibly damaging Het
Kif20b T C 19: 34,941,229 V671A possibly damaging Het
Kif28 T G 1: 179,716,755 I345L possibly damaging Het
Klri2 C G 6: 129,733,779 probably null Het
Kntc1 T C 5: 123,786,978 V1118A probably benign Het
Lpin2 T A 17: 71,204,876 I34N probably benign Het
Lrch3 T A 16: 32,981,829 V264D possibly damaging Het
Lrrk2 C T 15: 91,702,270 Q430* probably null Het
Map10 T G 8: 125,671,100 S411A probably benign Het
Map1a A T 2: 121,304,969 I2089F probably benign Het
Mypn T A 10: 63,169,377 Q317L probably damaging Het
Ncan T A 8: 70,102,521 I999F probably damaging Het
Nmrk2 C A 10: 81,199,705 R134L probably damaging Het
Olfr1290 C T 2: 111,489,697 V154I probably benign Het
Olfr181 T C 16: 58,926,070 N167S probably benign Het
Olfr5 A G 7: 6,480,247 V303A probably benign Het
Olfr583 T A 7: 103,052,108 V270E probably damaging Het
Olfr905 T A 9: 38,473,389 I214N probably damaging Het
Osbpl1a A G 18: 12,766,801 probably null Het
Pcdh1 T C 18: 38,199,020 D310G possibly damaging Het
Pkn2 C T 3: 142,811,913 probably null Het
Plch1 T A 3: 63,784,126 M31L probably damaging Het
Polg2 A G 11: 106,768,344 F448L probably damaging Het
Ppp4r3b A G 11: 29,200,758 T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 E558K probably damaging Het
Prdm9 T A 17: 15,544,008 I837F possibly damaging Het
R3hdm1 T A 1: 128,174,957 M125K possibly damaging Het
Rbm39 A T 2: 156,148,356 V468E probably damaging Het
Rnasel T A 1: 153,755,031 V431E probably damaging Het
Rps2 T A 17: 24,721,253 D220E probably benign Het
Rsf1 T C 7: 97,681,852 probably benign Het
Rsph10b G T 5: 143,977,134 A710S probably benign Het
Sez6 A T 11: 77,953,527 T59S probably damaging Het
Sf3b1 A T 1: 55,000,285 V727E probably damaging Het
Slit2 T G 5: 48,249,798 L857R probably damaging Het
Sspo T G 6: 48,448,570 C42G probably damaging Het
Strc C T 2: 121,370,989 D1245N probably benign Het
Supv3l1 T A 10: 62,432,339 T576S probably benign Het
Tecrl C T 5: 83,313,307 R101Q probably benign Het
Tmeff2 A G 1: 51,181,793 Y309C probably damaging Het
Tmem43 T A 6: 91,485,380 W316R probably damaging Het
Tmigd3 T C 3: 105,914,238 V141A probably benign Het
Trav9-1 T C 14: 53,488,127 F8L probably benign Het
Trbv5 T G 6: 41,062,707 F82C probably damaging Het
Ubtf T C 11: 102,314,976 N41S possibly damaging Het
Uggt1 T C 1: 36,158,148 T1225A probably benign Het
Vmn1r72 T C 7: 11,669,880 R214G possibly damaging Het
Vmn2r12 T G 5: 109,086,656 K563N possibly damaging Het
Vmn2r83 T C 10: 79,469,039 S28P probably benign Het
Vwa8 T G 14: 79,201,112 L1875R probably damaging Het
Xrcc6 T A 15: 82,029,665 V64E probably damaging Het
Zfp292 T C 4: 34,811,835 Y403C probably damaging Het
Zfp955a A T 17: 33,241,981 H392Q probably damaging Het
Zfyve19 T C 2: 119,210,809 S69P probably damaging Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGTGGCTGCTTGGGAAAG -3'
(R):5'- AGATGAAGGGGACACTCTCC -3'

Sequencing Primer
(F):5'- AAGGGGACATGCTCTGGCTG -3'
(R):5'- TCACTATGTGAGGACCTCCCCAG -3'
Posted On 2021-08-31