Incidental Mutation 'R8947:A2ml1'
ID 681376
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Name alpha-2-macroglobulin like 1
Synonyms BC048546, Ovos2
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 128516784-128558571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128529219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 974 (N974K)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
AlphaFold Q3UU35
Predicted Effect probably damaging
Transcript: ENSMUST00000060574
AA Change: N974K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: N974K

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128,555,119 (GRCm39) missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128,547,030 (GRCm39) missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128,529,270 (GRCm39) missense probably benign 0.04
IGL01320:A2ml1 APN 6 128,552,551 (GRCm39) missense probably benign 0.00
IGL01470:A2ml1 APN 6 128,557,375 (GRCm39) missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128,531,293 (GRCm39) splice site probably benign
IGL01761:A2ml1 APN 6 128,523,300 (GRCm39) missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128,537,642 (GRCm39) missense probably benign 0.04
IGL01843:A2ml1 APN 6 128,530,301 (GRCm39) splice site probably benign
IGL01946:A2ml1 APN 6 128,547,442 (GRCm39) missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128,535,298 (GRCm39) missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128,524,173 (GRCm39) missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128,530,301 (GRCm39) splice site probably benign
IGL02589:A2ml1 APN 6 128,558,463 (GRCm39) missense probably benign 0.00
IGL02959:A2ml1 APN 6 128,544,023 (GRCm39) missense probably benign 0.04
IGL02970:A2ml1 APN 6 128,546,942 (GRCm39) missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128,530,239 (GRCm39) missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128,520,923 (GRCm39) missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128,557,923 (GRCm39) missense probably benign 0.02
R0055:A2ml1 UTSW 6 128,547,057 (GRCm39) splice site probably benign
R0055:A2ml1 UTSW 6 128,547,057 (GRCm39) splice site probably benign
R0069:A2ml1 UTSW 6 128,538,525 (GRCm39) missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128,538,525 (GRCm39) missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128,552,602 (GRCm39) splice site probably benign
R0299:A2ml1 UTSW 6 128,530,195 (GRCm39) splice site probably benign
R0523:A2ml1 UTSW 6 128,535,289 (GRCm39) missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128,545,706 (GRCm39) nonsense probably null
R0599:A2ml1 UTSW 6 128,529,208 (GRCm39) missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128,527,736 (GRCm39) missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128,523,411 (GRCm39) missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128,537,609 (GRCm39) missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128,520,263 (GRCm39) missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128,547,880 (GRCm39) missense probably benign 0.00
R1278:A2ml1 UTSW 6 128,535,470 (GRCm39) missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128,520,923 (GRCm39) missense probably benign 0.00
R1536:A2ml1 UTSW 6 128,524,196 (GRCm39) nonsense probably null
R1786:A2ml1 UTSW 6 128,553,223 (GRCm39) missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128,520,262 (GRCm39) missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128,543,236 (GRCm39) missense probably benign 0.34
R1863:A2ml1 UTSW 6 128,527,746 (GRCm39) missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128,519,855 (GRCm39) missense probably benign 0.13
R2062:A2ml1 UTSW 6 128,529,271 (GRCm39) missense probably benign 0.08
R2127:A2ml1 UTSW 6 128,535,400 (GRCm39) missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128,553,223 (GRCm39) missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128,553,223 (GRCm39) missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128,524,268 (GRCm39) missense probably null 0.34
R2319:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2321:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2322:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2369:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2370:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2371:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2372:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2375:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2893:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R2894:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R3438:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R3615:A2ml1 UTSW 6 128,535,257 (GRCm39) missense probably benign 0.07
R3616:A2ml1 UTSW 6 128,535,257 (GRCm39) missense probably benign 0.07
R3773:A2ml1 UTSW 6 128,532,046 (GRCm39) missense probably benign 0.02
R3785:A2ml1 UTSW 6 128,521,887 (GRCm39) critical splice donor site probably null
R3803:A2ml1 UTSW 6 128,522,033 (GRCm39) missense probably benign 0.17
R3824:A2ml1 UTSW 6 128,545,726 (GRCm39) missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128,531,324 (GRCm39) missense probably benign 0.05
R4176:A2ml1 UTSW 6 128,522,000 (GRCm39) missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R4230:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R4348:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R4351:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R4352:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R4353:A2ml1 UTSW 6 128,557,349 (GRCm39) missense probably benign 0.01
R4427:A2ml1 UTSW 6 128,522,009 (GRCm39) missense probably benign 0.00
R4971:A2ml1 UTSW 6 128,524,190 (GRCm39) missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128,520,896 (GRCm39) missense probably benign 0.00
R5369:A2ml1 UTSW 6 128,545,796 (GRCm39) missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128,530,293 (GRCm39) critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128,518,024 (GRCm39) missense probably benign 0.15
R5872:A2ml1 UTSW 6 128,538,489 (GRCm39) missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128,537,608 (GRCm39) missense probably benign
R5977:A2ml1 UTSW 6 128,558,085 (GRCm39) missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128,544,018 (GRCm39) missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128,548,948 (GRCm39) missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128,526,799 (GRCm39) nonsense probably null
R6032:A2ml1 UTSW 6 128,526,799 (GRCm39) nonsense probably null
R6061:A2ml1 UTSW 6 128,545,675 (GRCm39) missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128,535,655 (GRCm39) splice site probably null
R6331:A2ml1 UTSW 6 128,529,199 (GRCm39) missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128,518,041 (GRCm39) missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128,530,248 (GRCm39) missense probably benign 0.41
R6792:A2ml1 UTSW 6 128,523,292 (GRCm39) nonsense probably null
R6793:A2ml1 UTSW 6 128,523,292 (GRCm39) nonsense probably null
R7207:A2ml1 UTSW 6 128,527,734 (GRCm39) missense probably benign 0.04
R7378:A2ml1 UTSW 6 128,523,210 (GRCm39) critical splice donor site probably null
R7556:A2ml1 UTSW 6 128,546,927 (GRCm39) missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128,557,303 (GRCm39) missense probably benign 0.08
R8017:A2ml1 UTSW 6 128,558,410 (GRCm39) critical splice donor site probably null
R8019:A2ml1 UTSW 6 128,558,410 (GRCm39) critical splice donor site probably null
R8035:A2ml1 UTSW 6 128,530,243 (GRCm39) missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128,549,045 (GRCm39) missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128,546,962 (GRCm39) missense possibly damaging 0.84
R8365:A2ml1 UTSW 6 128,557,918 (GRCm39) nonsense probably null
R8382:A2ml1 UTSW 6 128,537,645 (GRCm39) missense probably benign 0.01
R8388:A2ml1 UTSW 6 128,548,937 (GRCm39) missense probably benign 0.03
R8717:A2ml1 UTSW 6 128,543,958 (GRCm39) missense probably benign 0.00
R8970:A2ml1 UTSW 6 128,545,726 (GRCm39) missense probably damaging 0.99
R9025:A2ml1 UTSW 6 128,534,545 (GRCm39) missense possibly damaging 0.49
R9083:A2ml1 UTSW 6 128,534,524 (GRCm39) missense possibly damaging 0.90
R9129:A2ml1 UTSW 6 128,523,223 (GRCm39) missense probably damaging 1.00
R9145:A2ml1 UTSW 6 128,536,032 (GRCm39) missense probably benign
R9165:A2ml1 UTSW 6 128,537,632 (GRCm39) missense probably benign
R9285:A2ml1 UTSW 6 128,526,756 (GRCm39) missense probably benign
R9408:A2ml1 UTSW 6 128,522,030 (GRCm39) missense probably damaging 0.98
R9486:A2ml1 UTSW 6 128,546,942 (GRCm39) missense probably damaging 0.99
R9781:A2ml1 UTSW 6 128,519,860 (GRCm39) missense probably benign 0.01
RF014:A2ml1 UTSW 6 128,547,031 (GRCm39) missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128,548,975 (GRCm39) missense probably benign
Z1176:A2ml1 UTSW 6 128,548,940 (GRCm39) missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128,552,570 (GRCm39) missense possibly damaging 0.80
Z1177:A2ml1 UTSW 6 128,538,579 (GRCm39) nonsense probably null
Z1177:A2ml1 UTSW 6 128,522,039 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCACAGAGTAAGACTGATC -3'
(R):5'- GAGCCACCTCCTTCTAGAGTTC -3'

Sequencing Primer
(F):5'- CACAGAGTAAGACTGATCATGCTTTG -3'
(R):5'- TGTAGTGTTCACAAAGGCCC -3'
Posted On 2021-08-31