Incidental Mutation 'R0734:Cyp2j6'
ID68138
Institutional Source Beutler Lab
Gene Symbol Cyp2j6
Ensembl Gene ENSMUSG00000052914
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 6
Synonyms
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0734 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96516138-96553661 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 96523844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030303]
Predicted Effect probably benign
Transcript: ENSMUST00000030303
SMART Domains Protein: ENSMUSP00000030303
Gene: ENSMUSG00000052914

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 497 6.6e-138 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Cyp2j6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Cyp2j6 APN 4 96536046 missense possibly damaging 0.78
IGL01543:Cyp2j6 APN 4 96525924 missense possibly damaging 0.78
IGL02324:Cyp2j6 APN 4 96525933 missense probably damaging 0.99
IGL02727:Cyp2j6 APN 4 96545764 missense probably benign
IGL02963:Cyp2j6 APN 4 96518184 missense probably damaging 1.00
IGL03099:Cyp2j6 APN 4 96536091 missense possibly damaging 0.65
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0376:Cyp2j6 UTSW 4 96526023 missense probably damaging 0.99
R0448:Cyp2j6 UTSW 4 96545728 missense probably benign
R0471:Cyp2j6 UTSW 4 96531748 nonsense probably null
R1497:Cyp2j6 UTSW 4 96531661 missense probably damaging 1.00
R1686:Cyp2j6 UTSW 4 96523777 missense probably benign 0.08
R2079:Cyp2j6 UTSW 4 96531725 missense possibly damaging 0.87
R2293:Cyp2j6 UTSW 4 96529433 missense possibly damaging 0.87
R2350:Cyp2j6 UTSW 4 96529408 missense probably damaging 1.00
R2971:Cyp2j6 UTSW 4 96531781 missense probably benign 0.06
R3927:Cyp2j6 UTSW 4 96553288 missense probably benign 0.15
R4020:Cyp2j6 UTSW 4 96518170 missense probably benign 0.03
R5087:Cyp2j6 UTSW 4 96531699 missense probably damaging 0.99
R5309:Cyp2j6 UTSW 4 96535556 missense probably damaging 1.00
R5861:Cyp2j6 UTSW 4 96545803 missense possibly damaging 0.81
R5882:Cyp2j6 UTSW 4 96535602 missense probably benign 0.00
R6123:Cyp2j6 UTSW 4 96518029 makesense probably null
R6180:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6181:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6182:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6185:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6186:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6217:Cyp2j6 UTSW 4 96518161 missense probably damaging 1.00
R6784:Cyp2j6 UTSW 4 96535504 missense possibly damaging 0.70
R7038:Cyp2j6 UTSW 4 96535471 missense probably benign
R7146:Cyp2j6 UTSW 4 96545782 missense probably damaging 1.00
R7379:Cyp2j6 UTSW 4 96525946 missense probably damaging 0.99
R7470:Cyp2j6 UTSW 4 96535471 missense probably benign
R7536:Cyp2j6 UTSW 4 96535537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCCATTGAGAAGGGCAGAAAG -3'
(R):5'- GAGATGAAAGACACGCAATTCCGC -3'

Sequencing Primer
(F):5'- ACTCTTTTGGGTCTCTGTGCAG -3'
(R):5'- CCTCATTGTAGGAAGTAGCCG -3'
Posted On2013-09-03