Incidental Mutation 'R8947:Ncan'
ID 681383
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3, Cspg3-rs, neurocan, Tgfbit
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70093085-70120873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70102521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 999 (I999F)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002412
AA Change: I999F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: I999F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,097 S477T probably benign Het
4930562C15Rik T A 16: 4,847,428 F141L unknown Het
A2ml1 G T 6: 128,552,256 N974K probably damaging Het
Abcg8 T C 17: 84,691,818 L114P probably damaging Het
Akt3 A T 1: 177,131,079 W22R probably damaging Het
Ank2 C T 3: 126,942,747 probably benign Het
Ap1g1 C T 8: 109,863,332 probably benign Het
Arhgef19 T A 4: 141,246,307 V35E possibly damaging Het
Baz2b T C 2: 59,948,239 D759G probably benign Het
BC051665 C A 13: 60,782,190 G320W probably damaging Het
Bche T A 3: 73,701,428 T222S probably damaging Het
C8a T C 4: 104,822,129 D444G probably damaging Het
Cacna1e A T 1: 154,402,150 S2019T probably benign Het
Carm1 T C 9: 21,586,453 I373T probably damaging Het
Ccdc39 T C 3: 33,815,460 probably benign Het
Clic5 A T 17: 44,242,261 probably benign Het
Cntn3 A G 6: 102,437,903 F28L probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Cpb2 T C 14: 75,278,187 Y352H probably damaging Het
Cpeb3 A T 19: 37,174,966 D3E probably damaging Het
Ctsl T C 13: 64,367,026 T155A probably damaging Het
Cygb C T 11: 116,649,819 A114T probably damaging Het
Cyp11a1 T C 9: 58,017,455 V17A probably benign Het
Dhcr7 T G 7: 143,847,222 I374S probably damaging Het
Dhx36 T C 3: 62,472,966 R807G probably benign Het
Diaph1 A T 18: 37,853,701 V1077E probably damaging Het
Ehmt2 A G 17: 34,908,304 E131G possibly damaging Het
Evpl A G 11: 116,221,338 I1842T probably damaging Het
Fastk C A 5: 24,441,651 C294F probably damaging Het
Fndc5 T C 4: 129,137,136 C20R probably benign Het
Gm7298 C A 6: 121,780,594 Q1053K possibly damaging Het
Gm8362 A G 14: 6,773,326 probably null Het
Gmps T A 3: 63,998,677 I465N probably damaging Het
Heatr4 T G 12: 83,954,657 M904L probably benign Het
Hhip T A 8: 80,045,156 D175V probably damaging Het
Hmcn2 G A 2: 31,388,208 V1641M probably damaging Het
Hoxa5 T G 6: 52,202,796 T200P probably damaging Het
Ift122 C A 6: 115,924,407 A1050D probably benign Het
Igf2bp2 C A 16: 22,078,723 E247* probably null Het
Irak1bp1 T A 9: 82,846,793 L259H probably damaging Het
Irgm1 G A 11: 48,868,748 probably benign Het
Itih1 A T 14: 30,935,909 probably benign Het
Itpk1 A T 12: 102,570,323 C355S probably benign Het
Kcng4 T C 8: 119,625,713 E486G possibly damaging Het
Kif20b T C 19: 34,941,229 V671A possibly damaging Het
Kif28 T G 1: 179,716,755 I345L possibly damaging Het
Klri2 C G 6: 129,733,779 probably null Het
Kntc1 T C 5: 123,786,978 V1118A probably benign Het
Lpin2 T A 17: 71,204,876 I34N probably benign Het
Lrch3 T A 16: 32,981,829 V264D possibly damaging Het
Lrrk2 C T 15: 91,702,270 Q430* probably null Het
Map10 T G 8: 125,671,100 S411A probably benign Het
Map1a A T 2: 121,304,969 I2089F probably benign Het
Med12l T A 3: 59,077,022 probably benign Het
Mypn T A 10: 63,169,377 Q317L probably damaging Het
Nmrk2 C A 10: 81,199,705 R134L probably damaging Het
Olfr1290 C T 2: 111,489,697 V154I probably benign Het
Olfr181 T C 16: 58,926,070 N167S probably benign Het
Olfr5 A G 7: 6,480,247 V303A probably benign Het
Olfr583 T A 7: 103,052,108 V270E probably damaging Het
Olfr905 T A 9: 38,473,389 I214N probably damaging Het
Osbpl1a A G 18: 12,766,801 probably null Het
Pcdh1 T C 18: 38,199,020 D310G possibly damaging Het
Pkn2 C T 3: 142,811,913 probably null Het
Plch1 T A 3: 63,784,126 M31L probably damaging Het
Polg2 A G 11: 106,768,344 F448L probably damaging Het
Ppp4r3b A G 11: 29,200,758 T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 E558K probably damaging Het
Prdm9 T A 17: 15,544,008 I837F possibly damaging Het
R3hdm1 T A 1: 128,174,957 M125K possibly damaging Het
Rbm39 A T 2: 156,148,356 V468E probably damaging Het
Rnasel T A 1: 153,755,031 V431E probably damaging Het
Rps2 T A 17: 24,721,253 D220E probably benign Het
Rsf1 T C 7: 97,681,852 probably benign Het
Rsph10b G T 5: 143,977,134 A710S probably benign Het
Sez6 A T 11: 77,953,527 T59S probably damaging Het
Sf3b1 A T 1: 55,000,285 V727E probably damaging Het
Slit2 T G 5: 48,249,798 L857R probably damaging Het
Sspo T G 6: 48,448,570 C42G probably damaging Het
Strc C T 2: 121,370,989 D1245N probably benign Het
Supv3l1 T A 10: 62,432,339 T576S probably benign Het
Tecrl C T 5: 83,313,307 R101Q probably benign Het
Tmeff2 A G 1: 51,181,793 Y309C probably damaging Het
Tmem43 T A 6: 91,485,380 W316R probably damaging Het
Tmigd3 T C 3: 105,914,238 V141A probably benign Het
Trav9-1 T C 14: 53,488,127 F8L probably benign Het
Trbv5 T G 6: 41,062,707 F82C probably damaging Het
Ubtf T C 11: 102,314,976 N41S possibly damaging Het
Uggt1 T C 1: 36,158,148 T1225A probably benign Het
Vmn1r72 T C 7: 11,669,880 R214G possibly damaging Het
Vmn2r12 T G 5: 109,086,656 K563N possibly damaging Het
Vmn2r83 T C 10: 79,469,039 S28P probably benign Het
Vwa8 T G 14: 79,201,112 L1875R probably damaging Het
Xrcc6 T A 15: 82,029,665 V64E probably damaging Het
Zfp292 T C 4: 34,811,835 Y403C probably damaging Het
Zfp955a A T 17: 33,241,981 H392Q probably damaging Het
Zfyve19 T C 2: 119,210,809 S69P probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
R9324:Ncan UTSW 8 70107998 missense possibly damaging 0.75
R9717:Ncan UTSW 8 70101978 missense probably damaging 1.00
R9803:Ncan UTSW 8 70108101 missense probably benign 0.06
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCGCTATGTGTCCGTAATTTAAG -3'
(R):5'- TAAACTTTTGGGCTGCTGTACCC -3'

Sequencing Primer
(F):5'- GAGACTCACCCTTCTCACA -3'
(R):5'- TGTACCCCAAGTGCCTGAGTC -3'
Posted On 2021-08-31