Incidental Mutation 'R8947:Col6a5'
ID 681392
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Name collagen, type VI, alpha 5
Synonyms Gm7455, Col6a5
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 105733277-105837842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105822833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 175 (E175K)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000165165
AA Change: E175K
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: E175K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190193
AA Change: E175K
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: E175K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105,759,882 (GRCm39) missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105,823,274 (GRCm39) missense unknown
IGL01530:Col6a5 APN 9 105,792,385 (GRCm39) splice site probably benign
IGL01717:Col6a5 APN 9 105,817,472 (GRCm39) missense unknown
IGL01859:Col6a5 APN 9 105,808,160 (GRCm39) nonsense probably null
IGL01945:Col6a5 APN 9 105,805,489 (GRCm39) missense unknown
IGL01985:Col6a5 APN 9 105,814,482 (GRCm39) missense unknown
IGL02128:Col6a5 APN 9 105,817,093 (GRCm39) missense unknown
IGL02170:Col6a5 APN 9 105,805,621 (GRCm39) missense unknown
IGL02224:Col6a5 APN 9 105,741,534 (GRCm39) missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105,788,306 (GRCm39) nonsense probably null
IGL02304:Col6a5 APN 9 105,805,613 (GRCm39) missense unknown
IGL02338:Col6a5 APN 9 105,755,829 (GRCm39) missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105,783,312 (GRCm39) missense unknown
IGL02660:Col6a5 APN 9 105,814,085 (GRCm39) missense unknown
IGL02829:Col6a5 APN 9 105,811,506 (GRCm39) missense unknown
IGL02882:Col6a5 APN 9 105,811,520 (GRCm39) missense unknown
IGL02973:Col6a5 APN 9 105,803,020 (GRCm39) missense unknown
IGL03089:Col6a5 APN 9 105,811,038 (GRCm39) missense unknown
IGL03100:Col6a5 APN 9 105,814,512 (GRCm39) missense unknown
IGL03257:Col6a5 APN 9 105,759,072 (GRCm39) missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105,811,373 (GRCm39) missense unknown
FR4342:Col6a5 UTSW 9 105,811,373 (GRCm39) missense unknown
FR4589:Col6a5 UTSW 9 105,811,373 (GRCm39) missense unknown
PIT4131001:Col6a5 UTSW 9 105,759,113 (GRCm39) missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105,802,993 (GRCm39) missense unknown
R0549:Col6a5 UTSW 9 105,781,778 (GRCm39) splice site probably benign
R0622:Col6a5 UTSW 9 105,803,051 (GRCm39) missense unknown
R0628:Col6a5 UTSW 9 105,789,649 (GRCm39) splice site probably null
R0635:Col6a5 UTSW 9 105,805,805 (GRCm39) missense unknown
R0644:Col6a5 UTSW 9 105,825,523 (GRCm39) critical splice donor site probably null
R0828:Col6a5 UTSW 9 105,739,263 (GRCm39) critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105,817,484 (GRCm39) missense unknown
R1065:Col6a5 UTSW 9 105,758,982 (GRCm39) missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105,811,516 (GRCm39) missense unknown
R1169:Col6a5 UTSW 9 105,774,173 (GRCm39) splice site probably null
R1522:Col6a5 UTSW 9 105,817,193 (GRCm39) missense unknown
R1646:Col6a5 UTSW 9 105,739,948 (GRCm39) nonsense probably null
R1719:Col6a5 UTSW 9 105,808,492 (GRCm39) missense unknown
R1759:Col6a5 UTSW 9 105,808,045 (GRCm39) missense unknown
R1780:Col6a5 UTSW 9 105,814,077 (GRCm39) missense unknown
R1812:Col6a5 UTSW 9 105,805,253 (GRCm39) missense unknown
R1838:Col6a5 UTSW 9 105,742,032 (GRCm39) missense probably benign 0.28
R1839:Col6a5 UTSW 9 105,742,032 (GRCm39) missense probably benign 0.28
R1863:Col6a5 UTSW 9 105,817,400 (GRCm39) missense unknown
R1900:Col6a5 UTSW 9 105,808,412 (GRCm39) missense unknown
R1951:Col6a5 UTSW 9 105,814,156 (GRCm39) missense unknown
R2024:Col6a5 UTSW 9 105,814,193 (GRCm39) missense unknown
R2126:Col6a5 UTSW 9 105,822,799 (GRCm39) missense unknown
R2319:Col6a5 UTSW 9 105,814,417 (GRCm39) missense unknown
R2344:Col6a5 UTSW 9 105,805,736 (GRCm39) missense unknown
R2483:Col6a5 UTSW 9 105,741,347 (GRCm39) missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105,788,306 (GRCm39) nonsense probably null
R3276:Col6a5 UTSW 9 105,788,306 (GRCm39) nonsense probably null
R3438:Col6a5 UTSW 9 105,752,991 (GRCm39) missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105,741,868 (GRCm39) missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105,805,810 (GRCm39) missense unknown
R3886:Col6a5 UTSW 9 105,808,129 (GRCm39) missense unknown
R3941:Col6a5 UTSW 9 105,817,033 (GRCm39) missense unknown
R4194:Col6a5 UTSW 9 105,823,113 (GRCm39) missense unknown
R4399:Col6a5 UTSW 9 105,766,164 (GRCm39) missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105,805,672 (GRCm39) missense unknown
R4450:Col6a5 UTSW 9 105,781,720 (GRCm39) missense unknown
R4491:Col6a5 UTSW 9 105,817,211 (GRCm39) missense unknown
R4582:Col6a5 UTSW 9 105,739,963 (GRCm39) missense probably benign 0.17
R4693:Col6a5 UTSW 9 105,814,371 (GRCm39) missense unknown
R4787:Col6a5 UTSW 9 105,808,280 (GRCm39) missense unknown
R4789:Col6a5 UTSW 9 105,814,534 (GRCm39) missense unknown
R4791:Col6a5 UTSW 9 105,807,983 (GRCm39) missense unknown
R4792:Col6a5 UTSW 9 105,807,983 (GRCm39) missense unknown
R4817:Col6a5 UTSW 9 105,811,497 (GRCm39) missense unknown
R4854:Col6a5 UTSW 9 105,775,950 (GRCm39) missense probably benign 0.18
R4927:Col6a5 UTSW 9 105,811,163 (GRCm39) missense unknown
R4969:Col6a5 UTSW 9 105,741,806 (GRCm39) missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105,805,337 (GRCm39) missense unknown
R5118:Col6a5 UTSW 9 105,814,204 (GRCm39) missense unknown
R5144:Col6a5 UTSW 9 105,766,482 (GRCm39) missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105,811,444 (GRCm39) missense unknown
R5160:Col6a5 UTSW 9 105,808,208 (GRCm39) missense unknown
R5182:Col6a5 UTSW 9 105,734,531 (GRCm39) nonsense probably null
R5234:Col6a5 UTSW 9 105,741,404 (GRCm39) missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105,817,489 (GRCm39) missense unknown
R5290:Col6a5 UTSW 9 105,823,282 (GRCm39) missense unknown
R5313:Col6a5 UTSW 9 105,822,743 (GRCm39) missense unknown
R5321:Col6a5 UTSW 9 105,805,664 (GRCm39) missense unknown
R5466:Col6a5 UTSW 9 105,808,282 (GRCm39) missense unknown
R5540:Col6a5 UTSW 9 105,739,975 (GRCm39) missense probably benign 0.44
R5669:Col6a5 UTSW 9 105,803,197 (GRCm39) missense unknown
R5789:Col6a5 UTSW 9 105,741,807 (GRCm39) missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105,825,566 (GRCm39) missense unknown
R5827:Col6a5 UTSW 9 105,805,319 (GRCm39) nonsense probably null
R5839:Col6a5 UTSW 9 105,822,592 (GRCm39) critical splice donor site probably null
R5908:Col6a5 UTSW 9 105,740,000 (GRCm39) missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105,823,046 (GRCm39) missense unknown
R6045:Col6a5 UTSW 9 105,803,117 (GRCm39) missense unknown
R6107:Col6a5 UTSW 9 105,769,471 (GRCm39) nonsense probably null
R6168:Col6a5 UTSW 9 105,752,986 (GRCm39) critical splice donor site probably null
R6315:Col6a5 UTSW 9 105,759,169 (GRCm39) missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105,766,266 (GRCm39) missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105,769,465 (GRCm39) splice site probably null
R6434:Col6a5 UTSW 9 105,814,544 (GRCm39) missense unknown
R6456:Col6a5 UTSW 9 105,822,676 (GRCm39) missense unknown
R6698:Col6a5 UTSW 9 105,811,374 (GRCm39) missense unknown
R6876:Col6a5 UTSW 9 105,814,506 (GRCm39) missense unknown
R6882:Col6a5 UTSW 9 105,817,469 (GRCm39) nonsense probably null
R6928:Col6a5 UTSW 9 105,817,118 (GRCm39) missense unknown
R7024:Col6a5 UTSW 9 105,789,674 (GRCm39) nonsense probably null
R7038:Col6a5 UTSW 9 105,822,937 (GRCm39) missense unknown
R7082:Col6a5 UTSW 9 105,808,438 (GRCm39) missense unknown
R7158:Col6a5 UTSW 9 105,741,407 (GRCm39) missense possibly damaging 0.90
R7211:Col6a5 UTSW 9 105,805,363 (GRCm39) missense unknown
R7431:Col6a5 UTSW 9 105,805,468 (GRCm39) missense unknown
R7440:Col6a5 UTSW 9 105,758,630 (GRCm39) nonsense probably null
R7502:Col6a5 UTSW 9 105,753,075 (GRCm39) missense probably benign 0.05
R7577:Col6a5 UTSW 9 105,741,887 (GRCm39) nonsense probably null
R7582:Col6a5 UTSW 9 105,822,625 (GRCm39) missense unknown
R7641:Col6a5 UTSW 9 105,758,625 (GRCm39) nonsense probably null
R7762:Col6a5 UTSW 9 105,808,523 (GRCm39) missense unknown
R7793:Col6a5 UTSW 9 105,775,934 (GRCm39) missense probably damaging 1.00
R7821:Col6a5 UTSW 9 105,741,458 (GRCm39) missense probably damaging 1.00
R7848:Col6a5 UTSW 9 105,805,385 (GRCm39) missense unknown
R7897:Col6a5 UTSW 9 105,766,382 (GRCm39) missense possibly damaging 0.96
R7904:Col6a5 UTSW 9 105,805,720 (GRCm39) missense unknown
R7960:Col6a5 UTSW 9 105,823,049 (GRCm39) missense unknown
R8015:Col6a5 UTSW 9 105,758,940 (GRCm39) missense possibly damaging 0.65
R8100:Col6a5 UTSW 9 105,755,839 (GRCm39) missense probably damaging 1.00
R8131:Col6a5 UTSW 9 105,778,815 (GRCm39) missense unknown
R8418:Col6a5 UTSW 9 105,755,821 (GRCm39) missense probably damaging 1.00
R8425:Col6a5 UTSW 9 105,823,156 (GRCm39) missense unknown
R8678:Col6a5 UTSW 9 105,811,551 (GRCm39) missense unknown
R8690:Col6a5 UTSW 9 105,759,796 (GRCm39) missense probably damaging 0.97
R8847:Col6a5 UTSW 9 105,741,472 (GRCm39) missense possibly damaging 0.81
R8946:Col6a5 UTSW 9 105,822,833 (GRCm39) missense unknown
R8949:Col6a5 UTSW 9 105,822,833 (GRCm39) missense unknown
R8950:Col6a5 UTSW 9 105,822,833 (GRCm39) missense unknown
R9089:Col6a5 UTSW 9 105,766,142 (GRCm39) missense probably damaging 1.00
R9118:Col6a5 UTSW 9 105,755,853 (GRCm39) splice site probably benign
R9169:Col6a5 UTSW 9 105,822,596 (GRCm39) missense unknown
R9177:Col6a5 UTSW 9 105,808,152 (GRCm39) missense unknown
R9180:Col6a5 UTSW 9 105,739,178 (GRCm39) missense probably damaging 0.99
R9205:Col6a5 UTSW 9 105,755,837 (GRCm39) missense probably damaging 1.00
R9214:Col6a5 UTSW 9 105,758,940 (GRCm39) missense possibly damaging 0.65
R9224:Col6a5 UTSW 9 105,814,594 (GRCm39) missense unknown
R9279:Col6a5 UTSW 9 105,758,976 (GRCm39) missense probably damaging 1.00
R9383:Col6a5 UTSW 9 105,803,110 (GRCm39) missense unknown
R9427:Col6a5 UTSW 9 105,816,992 (GRCm39) missense unknown
R9488:Col6a5 UTSW 9 105,741,788 (GRCm39) missense probably damaging 1.00
R9494:Col6a5 UTSW 9 105,822,732 (GRCm39) missense unknown
R9659:Col6a5 UTSW 9 105,811,034 (GRCm39) missense unknown
R9749:Col6a5 UTSW 9 105,739,190 (GRCm39) missense probably damaging 0.98
RF013:Col6a5 UTSW 9 105,755,796 (GRCm39) frame shift probably null
X0054:Col6a5 UTSW 9 105,792,357 (GRCm39) missense unknown
X0058:Col6a5 UTSW 9 105,758,977 (GRCm39) nonsense probably null
Z1088:Col6a5 UTSW 9 105,803,266 (GRCm39) missense unknown
Z1177:Col6a5 UTSW 9 105,807,984 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATCAACGTGGTTGGCAGCTG -3'
(R):5'- GGCTCACAGGACCTATTTCTCTG -3'

Sequencing Primer
(F):5'- GGCAGCTGTGGTTAGAGC -3'
(R):5'- TCTCTGCTCCCACAAATGG -3'
Posted On 2021-08-31