Incidental Mutation 'R8947:Itpk1'
ID 681405
Institutional Source Beutler Lab
Gene Symbol Itpk1
Ensembl Gene ENSMUSG00000057963
Gene Name inositol 1,3,4-triphosphate 5/6 kinase
Synonyms
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.923) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 102534842-102671128 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102536582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 355 (C355S)
Ref Sequence ENSEMBL: ENSMUSP00000046027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046518]
AlphaFold Q8BYN3
Predicted Effect probably benign
Transcript: ENSMUST00000046518
AA Change: C355S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046027
Gene: ENSMUSG00000057963
AA Change: C355S

DomainStartEndE-ValueType
Pfam:Ins134_P3_kin 1 318 2.8e-142 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mice homozygous for a gene trap allele exhibit neural tube defects (exencephaly and spina bifida), growth retardation, kyphoscoliosis, and rib formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Itpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Itpk1 APN 12 102,572,362 (GRCm39) missense probably damaging 1.00
IGL02247:Itpk1 APN 12 102,589,668 (GRCm39) missense probably damaging 1.00
IGL02998:Itpk1 APN 12 102,545,398 (GRCm39) missense probably damaging 1.00
ANU23:Itpk1 UTSW 12 102,572,362 (GRCm39) missense probably damaging 1.00
R0432:Itpk1 UTSW 12 102,572,337 (GRCm39) splice site probably benign
R0622:Itpk1 UTSW 12 102,540,239 (GRCm39) missense probably damaging 1.00
R0659:Itpk1 UTSW 12 102,572,337 (GRCm39) splice site probably benign
R0835:Itpk1 UTSW 12 102,641,707 (GRCm39) missense probably damaging 1.00
R1171:Itpk1 UTSW 12 102,572,378 (GRCm39) missense probably damaging 1.00
R1812:Itpk1 UTSW 12 102,540,317 (GRCm39) missense probably benign 0.01
R1968:Itpk1 UTSW 12 102,641,729 (GRCm39) splice site probably null
R2277:Itpk1 UTSW 12 102,536,519 (GRCm39) missense probably benign
R2926:Itpk1 UTSW 12 102,545,389 (GRCm39) missense probably damaging 1.00
R4584:Itpk1 UTSW 12 102,536,416 (GRCm39) missense possibly damaging 0.89
R4690:Itpk1 UTSW 12 102,572,434 (GRCm39) missense probably damaging 0.96
R5050:Itpk1 UTSW 12 102,671,069 (GRCm39) missense probably damaging 1.00
R5326:Itpk1 UTSW 12 102,540,225 (GRCm39) missense possibly damaging 0.49
R5801:Itpk1 UTSW 12 102,540,204 (GRCm39) missense probably damaging 1.00
R5945:Itpk1 UTSW 12 102,554,812 (GRCm39) missense probably damaging 0.97
R7262:Itpk1 UTSW 12 102,641,712 (GRCm39) missense possibly damaging 0.89
R7421:Itpk1 UTSW 12 102,540,324 (GRCm39) missense possibly damaging 0.92
R7883:Itpk1 UTSW 12 102,572,434 (GRCm39) missense probably benign 0.35
R8438:Itpk1 UTSW 12 102,572,418 (GRCm39) start gained probably benign
R8886:Itpk1 UTSW 12 102,550,604 (GRCm39) unclassified probably benign
R9137:Itpk1 UTSW 12 102,540,291 (GRCm39) missense probably benign 0.00
R9716:Itpk1 UTSW 12 102,572,347 (GRCm39) critical splice donor site probably null
X0058:Itpk1 UTSW 12 102,540,283 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCATTTTCCACGCTCTG -3'
(R):5'- CTCCAGGCTATGAAGGAGTG -3'

Sequencing Primer
(F):5'- TGGCTACTGTGAGGAAGCC -3'
(R):5'- AGTGAGTGAGTTCTTTACCGACCTC -3'
Posted On 2021-08-31