Incidental Mutation 'R8947:Vwa8'
ID 681411
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Name von Willebrand factor A domain containing 8
Synonyms 1300010F03Rik, 4932416F07Rik
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8947 (G1)
Quality Score 144.008
Status Validated
Chromosome 14
Chromosomal Location 79086492-79439750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 79438552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 1875 (L1875R)
Ref Sequence ENSEMBL: ENSMUSP00000048925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990]
AlphaFold Q8CC88
Predicted Effect probably damaging
Transcript: ENSMUST00000040990
AA Change: L1875R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: L1875R

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79,275,635 (GRCm39) missense probably damaging 1.00
IGL01087:Vwa8 APN 14 79,172,669 (GRCm39) missense probably benign 0.16
IGL01137:Vwa8 APN 14 79,341,087 (GRCm39) missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79,302,353 (GRCm39) nonsense probably null
IGL01449:Vwa8 APN 14 79,420,428 (GRCm39) nonsense probably null
IGL01604:Vwa8 APN 14 79,418,244 (GRCm39) missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79,435,794 (GRCm39) missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79,435,717 (GRCm39) missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79,331,724 (GRCm39) missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 79,221,649 (GRCm39) missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 79,086,733 (GRCm39) missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 79,184,713 (GRCm39) critical splice donor site probably null
IGL02393:Vwa8 APN 14 79,420,417 (GRCm39) missense probably damaging 1.00
IGL02430:Vwa8 APN 14 79,172,085 (GRCm39) critical splice donor site probably null
IGL02476:Vwa8 APN 14 79,162,781 (GRCm39) missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79,420,552 (GRCm39) missense probably benign 0.01
IGL02678:Vwa8 APN 14 79,221,640 (GRCm39) missense probably damaging 0.99
IGL02797:Vwa8 APN 14 79,162,702 (GRCm39) missense probably benign 0.29
IGL02806:Vwa8 APN 14 79,394,528 (GRCm39) missense probably benign 0.35
IGL02811:Vwa8 APN 14 79,231,899 (GRCm39) missense probably benign 0.21
IGL02892:Vwa8 APN 14 79,341,140 (GRCm39) splice site probably benign
IGL03024:Vwa8 APN 14 79,232,538 (GRCm39) missense probably benign 0.03
IGL03075:Vwa8 APN 14 79,171,196 (GRCm39) missense probably damaging 0.99
IGL03090:Vwa8 APN 14 79,172,041 (GRCm39) missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79,296,255 (GRCm39) splice site probably benign
IGL03181:Vwa8 APN 14 79,246,690 (GRCm39) missense probably benign 0.01
IGL03296:Vwa8 APN 14 79,420,540 (GRCm39) missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79,420,574 (GRCm39) splice site probably null
R6812_Vwa8_870 UTSW 14 79,434,859 (GRCm39) missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79,302,361 (GRCm39) missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79,420,501 (GRCm39) missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79,331,179 (GRCm39) missense probably benign 0.21
R0063:Vwa8 UTSW 14 79,401,656 (GRCm39) splice site probably benign
R0063:Vwa8 UTSW 14 79,401,656 (GRCm39) splice site probably benign
R0081:Vwa8 UTSW 14 79,320,222 (GRCm39) missense probably benign 0.02
R0305:Vwa8 UTSW 14 79,246,713 (GRCm39) missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79,300,116 (GRCm39) missense probably damaging 1.00
R0514:Vwa8 UTSW 14 79,184,629 (GRCm39) missense probably benign
R0602:Vwa8 UTSW 14 79,258,060 (GRCm39) missense probably benign 0.00
R0615:Vwa8 UTSW 14 79,145,590 (GRCm39) missense probably benign
R0791:Vwa8 UTSW 14 79,232,016 (GRCm39) splice site probably benign
R1028:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79,324,094 (GRCm39) nonsense probably null
R1404:Vwa8 UTSW 14 79,263,471 (GRCm39) missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79,263,471 (GRCm39) missense probably damaging 1.00
R1412:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1421:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79,341,134 (GRCm39) nonsense probably null
R1467:Vwa8 UTSW 14 79,341,134 (GRCm39) nonsense probably null
R1539:Vwa8 UTSW 14 79,300,002 (GRCm39) missense probably benign 0.00
R1556:Vwa8 UTSW 14 79,324,121 (GRCm39) missense probably benign
R1589:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1590:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1591:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79,420,427 (GRCm39) missense probably damaging 1.00
R1673:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79,438,543 (GRCm39) missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 79,145,635 (GRCm39) missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79,318,576 (GRCm39) missense probably benign 0.04
R1926:Vwa8 UTSW 14 79,258,075 (GRCm39) missense probably benign 0.00
R1959:Vwa8 UTSW 14 79,219,800 (GRCm39) missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 79,162,694 (GRCm39) splice site probably benign
R2078:Vwa8 UTSW 14 79,145,597 (GRCm39) missense probably damaging 1.00
R2103:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79,329,843 (GRCm39) critical splice donor site probably null
R2281:Vwa8 UTSW 14 79,302,436 (GRCm39) missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 79,149,658 (GRCm39) missense probably damaging 0.98
R2847:Vwa8 UTSW 14 79,184,582 (GRCm39) missense probably benign 0.00
R2848:Vwa8 UTSW 14 79,184,582 (GRCm39) missense probably benign 0.00
R2894:Vwa8 UTSW 14 79,275,578 (GRCm39) missense probably damaging 1.00
R2991:Vwa8 UTSW 14 79,232,589 (GRCm39) missense probably benign 0.00
R3077:Vwa8 UTSW 14 79,335,782 (GRCm39) missense probably benign 0.03
R3405:Vwa8 UTSW 14 79,401,660 (GRCm39) splice site probably benign
R3406:Vwa8 UTSW 14 79,401,660 (GRCm39) splice site probably benign
R3708:Vwa8 UTSW 14 79,300,136 (GRCm39) splice site probably benign
R3779:Vwa8 UTSW 14 79,339,762 (GRCm39) splice site probably benign
R3799:Vwa8 UTSW 14 79,302,336 (GRCm39) missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79,320,292 (GRCm39) missense probably benign 0.00
R4425:Vwa8 UTSW 14 79,320,246 (GRCm39) missense probably benign 0.00
R4478:Vwa8 UTSW 14 79,106,241 (GRCm39) missense probably benign 0.00
R4627:Vwa8 UTSW 14 79,341,137 (GRCm39) critical splice donor site probably null
R4835:Vwa8 UTSW 14 79,172,053 (GRCm39) missense probably benign 0.11
R4868:Vwa8 UTSW 14 79,420,522 (GRCm39) missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79,435,723 (GRCm39) missense probably benign 0.05
R5137:Vwa8 UTSW 14 79,302,342 (GRCm39) missense probably damaging 1.00
R5156:Vwa8 UTSW 14 79,221,666 (GRCm39) missense probably benign 0.00
R5658:Vwa8 UTSW 14 79,219,838 (GRCm39) critical splice donor site probably null
R5841:Vwa8 UTSW 14 79,231,958 (GRCm39) missense probably benign
R6057:Vwa8 UTSW 14 79,320,313 (GRCm39) missense probably benign 0.21
R6244:Vwa8 UTSW 14 79,324,102 (GRCm39) missense probably benign
R6264:Vwa8 UTSW 14 79,324,252 (GRCm39) missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79,331,772 (GRCm39) splice site probably null
R6332:Vwa8 UTSW 14 79,434,904 (GRCm39) missense probably benign
R6395:Vwa8 UTSW 14 79,331,184 (GRCm39) missense probably benign 0.02
R6472:Vwa8 UTSW 14 79,246,610 (GRCm39) missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79,333,841 (GRCm39) missense probably benign 0.00
R6527:Vwa8 UTSW 14 79,184,653 (GRCm39) missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79,435,662 (GRCm39) missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79,434,859 (GRCm39) missense probably damaging 0.99
R6994:Vwa8 UTSW 14 79,145,596 (GRCm39) missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 79,149,645 (GRCm39) missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79,275,641 (GRCm39) missense probably null 1.00
R7363:Vwa8 UTSW 14 79,256,147 (GRCm39) missense probably benign 0.05
R7381:Vwa8 UTSW 14 79,333,125 (GRCm39) missense probably benign 0.00
R7406:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79,320,254 (GRCm39) missense probably benign 0.24
R7500:Vwa8 UTSW 14 79,162,686 (GRCm39) splice site probably null
R7514:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 79,172,669 (GRCm39) missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79,335,740 (GRCm39) missense probably benign
R7703:Vwa8 UTSW 14 79,263,513 (GRCm39) missense probably damaging 1.00
R7730:Vwa8 UTSW 14 79,232,589 (GRCm39) missense probably benign 0.00
R7775:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7778:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7824:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7885:Vwa8 UTSW 14 79,258,089 (GRCm39) missense probably benign 0.00
R7902:Vwa8 UTSW 14 79,329,731 (GRCm39) missense probably benign 0.00
R8262:Vwa8 UTSW 14 79,171,272 (GRCm39) critical splice donor site probably null
R8458:Vwa8 UTSW 14 79,302,332 (GRCm39) missense probably damaging 1.00
R8495:Vwa8 UTSW 14 79,174,617 (GRCm39) nonsense probably null
R8557:Vwa8 UTSW 14 79,246,649 (GRCm39) missense probably damaging 1.00
R8841:Vwa8 UTSW 14 79,184,702 (GRCm39) missense probably benign 0.04
R8906:Vwa8 UTSW 14 79,329,815 (GRCm39) missense probably benign 0.00
R9034:Vwa8 UTSW 14 79,296,179 (GRCm39) missense probably damaging 1.00
R9051:Vwa8 UTSW 14 79,324,150 (GRCm39) missense probably benign 0.00
R9179:Vwa8 UTSW 14 79,335,801 (GRCm39) missense probably benign
R9433:Vwa8 UTSW 14 79,335,871 (GRCm39) critical splice donor site probably null
R9455:Vwa8 UTSW 14 79,300,115 (GRCm39) missense probably damaging 1.00
R9496:Vwa8 UTSW 14 79,258,122 (GRCm39) missense probably benign
R9530:Vwa8 UTSW 14 79,172,639 (GRCm39) missense probably benign 0.33
R9584:Vwa8 UTSW 14 79,394,549 (GRCm39) missense probably benign
R9763:Vwa8 UTSW 14 79,186,988 (GRCm39) missense probably damaging 1.00
Z1088:Vwa8 UTSW 14 79,219,686 (GRCm39) missense probably benign 0.38
Z1177:Vwa8 UTSW 14 79,296,132 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAGAGACAGACAATTGAGC -3'
(R):5'- AACCCGTTTCCTTTGCAGAC -3'

Sequencing Primer
(F):5'- CAATTGAGCTGCAGGTAAGGTATG -3'
(R):5'- CAGAGTACACTTCTACTCGTAGG -3'
Posted On 2021-08-31