Mutagenetix > Incidental Mutation

Incidental Mutation 'R8947:Lrrk2'

681413

Institutional Source

Beutler Lab

Gene Symbol

Lrrk2

Ensembl Gene

ENSMUSG00000036273

Gene Name

leucine-rich repeat kinase 2

Synonyms

9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik

MMRRC Submission

Accession Numbers

Genbank: NM_025730; MGI: 1913975

Essential gene?

Possibly essential (E-score: 0.576) question?

Stock #

R8947 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91673175-91816120 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 91702270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 430 (Q430*)

Ref Sequence

ENSEMBL: ENSMUSP00000052584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060642]

AlphaFold

Q5S006

Predicted Effect

probably null
Transcript: ENSMUST00000060642
AA Change: Q430*

SMART Domains

Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: Q430*

Domain	Start	End	E-Value	Type
low complexity region	138	156	N/A	INTRINSIC
low complexity region	332	347	N/A	INTRINSIC
ANK	708	737	3.95e1	SMART
ANK	770	800	4.58e2	SMART
low complexity region	890	901	N/A	INTRINSIC
low complexity region	953	966	N/A	INTRINSIC
low complexity region	971	979	N/A	INTRINSIC
LRR	1010	1033	9.96e-1	SMART
LRR	1034	1057	8.01e0	SMART
LRR	1082	1105	2.45e0	SMART
LRR	1128	1151	9.3e-1	SMART
LRR	1195	1219	3.24e0	SMART
LRR	1244	1266	3.87e1	SMART
LRR	1267	1291	4.98e1	SMART
Pfam:Roc	1336	1456	4.9e-32	PFAM
Pfam:Ras	1336	1489	3.3e-17	PFAM
Pfam:COR	1524	1740	4e-28	PFAM
Pfam:Pkinase	1881	2132	4.7e-40	PFAM
Pfam:Pkinase_Tyr	1882	2132	6.8e-39	PFAM
WD40	2231	2276	3.09e-1	SMART
WD40	2401	2438	1.37e2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,972,097	S477T	probably benign	Het
4930562C15Rik	T	A	16: 4,847,428	F141L	unknown	Het
A2ml1	G	T	6: 128,552,256	N974K	probably damaging	Het
Abcg8	T	C	17: 84,691,818	L114P	probably damaging	Het
Akt3	A	T	1: 177,131,079	W22R	probably damaging	Het
Ank2	C	T	3: 126,942,747		probably benign	Het
Ap1g1	C	T	8: 109,863,332		probably benign	Het
Arhgef19	T	A	4: 141,246,307	V35E	possibly damaging	Het
Baz2b	T	C	2: 59,948,239	D759G	probably benign	Het
BC051665	C	A	13: 60,782,190	G320W	probably damaging	Het
Bche	T	A	3: 73,701,428	T222S	probably damaging	Het
C8a	T	C	4: 104,822,129	D444G	probably damaging	Het
Cacna1e	A	T	1: 154,402,150	S2019T	probably benign	Het
Carm1	T	C	9: 21,586,453	I373T	probably damaging	Het
Ccdc39	T	C	3: 33,815,460		probably benign	Het
Clic5	A	T	17: 44,242,261		probably benign	Het
Cntn3	A	G	6: 102,437,903	F28L	probably damaging	Het
Col6a5	C	T	9: 105,945,634	E175K	unknown	Het
Cpb2	T	C	14: 75,278,187	Y352H	probably damaging	Het
Cpeb3	A	T	19: 37,174,966	D3E	probably damaging	Het
Ctsl	T	C	13: 64,367,026	T155A	probably damaging	Het
Cygb	C	T	11: 116,649,819	A114T	probably damaging	Het
Cyp11a1	T	C	9: 58,017,455	V17A	probably benign	Het
Dhcr7	T	G	7: 143,847,222	I374S	probably damaging	Het
Dhx36	T	C	3: 62,472,966	R807G	probably benign	Het
Diaph1	A	T	18: 37,853,701	V1077E	probably damaging	Het
Ehmt2	A	G	17: 34,908,304	E131G	possibly damaging	Het
Evpl	A	G	11: 116,221,338	I1842T	probably damaging	Het
Fastk	C	A	5: 24,441,651	C294F	probably damaging	Het
Fndc5	T	C	4: 129,137,136	C20R	probably benign	Het
Gm7298	C	A	6: 121,780,594	Q1053K	possibly damaging	Het
Gm8362	A	G	14: 6,773,326		probably null	Het
Gmps	T	A	3: 63,998,677	I465N	probably damaging	Het
Heatr4	T	G	12: 83,954,657	M904L	probably benign	Het
Hhip	T	A	8: 80,045,156	D175V	probably damaging	Het
Hmcn2	G	A	2: 31,388,208	V1641M	probably damaging	Het
Hoxa5	T	G	6: 52,202,796	T200P	probably damaging	Het
Ift122	C	A	6: 115,924,407	A1050D	probably benign	Het
Igf2bp2	C	A	16: 22,078,723	E247*	probably null	Het
Irak1bp1	T	A	9: 82,846,793	L259H	probably damaging	Het
Irgm1	G	A	11: 48,868,748		probably benign	Het
Itih1	A	T	14: 30,935,909		probably benign	Het
Itpk1	A	T	12: 102,570,323	C355S	probably benign	Het
Kcng4	T	C	8: 119,625,713	E486G	possibly damaging	Het
Kif20b	T	C	19: 34,941,229	V671A	possibly damaging	Het
Kif28	T	G	1: 179,716,755	I345L	possibly damaging	Het
Klri2	C	G	6: 129,733,779		probably null	Het
Kntc1	T	C	5: 123,786,978	V1118A	probably benign	Het
Lpin2	T	A	17: 71,204,876	I34N	probably benign	Het
Lrch3	T	A	16: 32,981,829	V264D	possibly damaging	Het
Map10	T	G	8: 125,671,100	S411A	probably benign	Het
Map1a	A	T	2: 121,304,969	I2089F	probably benign	Het
Med12l	T	A	3: 59,077,022		probably benign	Het
Mypn	T	A	10: 63,169,377	Q317L	probably damaging	Het
Ncan	T	A	8: 70,102,521	I999F	probably damaging	Het
Nmrk2	C	A	10: 81,199,705	R134L	probably damaging	Het
Olfr1290	C	T	2: 111,489,697	V154I	probably benign	Het
Olfr181	T	C	16: 58,926,070	N167S	probably benign	Het
Olfr5	A	G	7: 6,480,247	V303A	probably benign	Het
Olfr583	T	A	7: 103,052,108	V270E	probably damaging	Het
Olfr905	T	A	9: 38,473,389	I214N	probably damaging	Het
Osbpl1a	A	G	18: 12,766,801		probably null	Het
Pcdh1	T	C	18: 38,199,020	D310G	possibly damaging	Het
Pkn2	C	T	3: 142,811,913		probably null	Het
Plch1	T	A	3: 63,784,126	M31L	probably damaging	Het
Polg2	A	G	11: 106,768,344	F448L	probably damaging	Het
Ppp4r3b	A	G	11: 29,200,758	T475A	possibly damaging	Het
Prdm13	C	T	4: 21,678,817	E558K	probably damaging	Het
Prdm9	T	A	17: 15,544,008	I837F	possibly damaging	Het
R3hdm1	T	A	1: 128,174,957	M125K	possibly damaging	Het
Rbm39	A	T	2: 156,148,356	V468E	probably damaging	Het
Rnasel	T	A	1: 153,755,031	V431E	probably damaging	Het
Rps2	T	A	17: 24,721,253	D220E	probably benign	Het
Rsf1	T	C	7: 97,681,852		probably benign	Het
Rsph10b	G	T	5: 143,977,134	A710S	probably benign	Het
Sez6	A	T	11: 77,953,527	T59S	probably damaging	Het
Sf3b1	A	T	1: 55,000,285	V727E	probably damaging	Het
Slit2	T	G	5: 48,249,798	L857R	probably damaging	Het
Sspo	T	G	6: 48,448,570	C42G	probably damaging	Het
Strc	C	T	2: 121,370,989	D1245N	probably benign	Het
Supv3l1	T	A	10: 62,432,339	T576S	probably benign	Het
Tecrl	C	T	5: 83,313,307	R101Q	probably benign	Het
Tmeff2	A	G	1: 51,181,793	Y309C	probably damaging	Het
Tmem43	T	A	6: 91,485,380	W316R	probably damaging	Het
Tmigd3	T	C	3: 105,914,238	V141A	probably benign	Het
Trav9-1	T	C	14: 53,488,127	F8L	probably benign	Het
Trbv5	T	G	6: 41,062,707	F82C	probably damaging	Het
Ubtf	T	C	11: 102,314,976	N41S	possibly damaging	Het
Uggt1	T	C	1: 36,158,148	T1225A	probably benign	Het
Vmn1r72	T	C	7: 11,669,880	R214G	possibly damaging	Het
Vmn2r12	T	G	5: 109,086,656	K563N	possibly damaging	Het
Vmn2r83	T	C	10: 79,469,039	S28P	probably benign	Het
Vwa8	T	G	14: 79,201,112	L1875R	probably damaging	Het
Xrcc6	T	A	15: 82,029,665	V64E	probably damaging	Het
Zfp292	T	C	4: 34,811,835	Y403C	probably damaging	Het
Zfp955a	A	T	17: 33,241,981	H392Q	probably damaging	Het
Zfyve19	T	C	2: 119,210,809	S69P	probably damaging	Het

Other mutations in Lrrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Lrrk2	APN	15	91747799	missense	possibly damaging	0.90
IGL00542:Lrrk2	APN	15	91699943	missense	probably benign
IGL00770:Lrrk2	APN	15	91801833	splice site	probably benign
IGL00774:Lrrk2	APN	15	91801833	splice site	probably benign
IGL00791:Lrrk2	APN	15	91779841	missense	probably damaging	1.00
IGL00827:Lrrk2	APN	15	91755790	missense	probably damaging	1.00
IGL00843:Lrrk2	APN	15	91757058	missense	possibly damaging	0.58
IGL01109:Lrrk2	APN	15	91738832	missense	probably damaging	1.00
IGL01293:Lrrk2	APN	15	91726137	missense	probably benign	0.21
IGL01296:Lrrk2	APN	15	91683142	missense	probably benign
IGL01301:Lrrk2	APN	15	91767339	missense	probably damaging	1.00
IGL01360:Lrrk2	APN	15	91700569	splice site	probably null
IGL01465:Lrrk2	APN	15	91728925	missense	probably benign	0.21
IGL01529:Lrrk2	APN	15	91812313	missense	possibly damaging	0.92
IGL01557:Lrrk2	APN	15	91699989	missense	probably damaging	1.00
IGL01560:Lrrk2	APN	15	91774988	missense	probably benign	0.33
IGL01991:Lrrk2	APN	15	91779946	missense	probably damaging	0.99
IGL02003:Lrrk2	APN	15	91731491	missense	probably damaging	0.99
IGL02325:Lrrk2	APN	15	91726308	critical splice donor site	probably null
IGL02711:Lrrk2	APN	15	91685822	missense	possibly damaging	0.71
IGL02869:Lrrk2	APN	15	91750277	missense	probably damaging	1.00
IGL03104:Lrrk2	APN	15	91747755	missense	possibly damaging	0.68
IGL03179:Lrrk2	APN	15	91700578	missense	probably damaging	1.00
IGL03395:Lrrk2	APN	15	91797414	splice site	probably null
horned	UTSW	15	91772858	missense	probably damaging	1.00
R1312_Lrrk2_980	UTSW	15	91699895	missense	probably damaging	1.00
R4710_lrrk2_232	UTSW	15	91699927	missense	possibly damaging	0.88
R5245_Lrrk2_127	UTSW	15	91796089	missense	probably damaging	1.00
spree	UTSW	15	91702247	missense	probably benign	0.00
Spur	UTSW	15	91774995	nonsense	probably null
3-1:Lrrk2	UTSW	15	91801934	missense	probably benign	0.01
ANU18:Lrrk2	UTSW	15	91767339	missense	probably damaging	1.00
H8562:Lrrk2	UTSW	15	91673358	missense	probably benign
H8786:Lrrk2	UTSW	15	91673358	missense	probably benign
IGL02835:Lrrk2	UTSW	15	91814660	critical splice acceptor site	probably null
R0014:Lrrk2	UTSW	15	91802045	splice site	probably benign
R0014:Lrrk2	UTSW	15	91802045	splice site	probably benign
R0078:Lrrk2	UTSW	15	91734009	missense	probably benign	0.01
R0100:Lrrk2	UTSW	15	91745796	missense	probably damaging	1.00
R0282:Lrrk2	UTSW	15	91778414	splice site	probably benign
R0448:Lrrk2	UTSW	15	91709305	missense	probably damaging	0.99
R0449:Lrrk2	UTSW	15	91750275	missense	probably damaging	1.00
R0610:Lrrk2	UTSW	15	91815416	missense	probably benign
R0617:Lrrk2	UTSW	15	91752278	missense	probably benign	0.00
R0632:Lrrk2	UTSW	15	91796028	missense	probably damaging	0.98
R0639:Lrrk2	UTSW	15	91772996	missense	probably benign	0.03
R0661:Lrrk2	UTSW	15	91787016	missense	probably damaging	1.00
R0666:Lrrk2	UTSW	15	91757070	critical splice donor site	probably null
R0764:Lrrk2	UTSW	15	91775046	splice site	probably null
R0766:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R0845:Lrrk2	UTSW	15	91755962	missense	probably benign	0.22
R0940:Lrrk2	UTSW	15	91729081	missense	possibly damaging	0.83
R0970:Lrrk2	UTSW	15	91729169	missense	probably benign	0.22
R1080:Lrrk2	UTSW	15	91673689	missense	probably benign	0.01
R1114:Lrrk2	UTSW	15	91700468	nonsense	probably null
R1223:Lrrk2	UTSW	15	91673635	missense	probably benign	0.00
R1289:Lrrk2	UTSW	15	91812360	missense	probably benign	0.00
R1296:Lrrk2	UTSW	15	91728920	missense	probably damaging	1.00
R1312:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R1637:Lrrk2	UTSW	15	91734058	missense	probably benign
R1773:Lrrk2	UTSW	15	91779981	missense	possibly damaging	0.96
R1809:Lrrk2	UTSW	15	91699892	missense	possibly damaging	0.86
R1839:Lrrk2	UTSW	15	91683134	missense	probably benign	0.00
R1946:Lrrk2	UTSW	15	91736661	splice site	probably null
R2160:Lrrk2	UTSW	15	91796060	missense	probably damaging	1.00
R2232:Lrrk2	UTSW	15	91764716	missense	probably benign	0.05
R2419:Lrrk2	UTSW	15	91797526	splice site	probably benign
R2516:Lrrk2	UTSW	15	91755927	missense	probably benign
R3110:Lrrk2	UTSW	15	91814695	missense	probably benign	0.02
R3112:Lrrk2	UTSW	15	91814695	missense	probably benign	0.02
R3801:Lrrk2	UTSW	15	91737111	missense	probably benign
R3842:Lrrk2	UTSW	15	91755916	missense	probably benign	0.01
R3903:Lrrk2	UTSW	15	91747700	missense	probably damaging	1.00
R3903:Lrrk2	UTSW	15	91747701	missense	probably damaging	1.00
R3930:Lrrk2	UTSW	15	91767461	critical splice donor site	probably null
R3937:Lrrk2	UTSW	15	91778504	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91712780	missense	possibly damaging	0.69
R3938:Lrrk2	UTSW	15	91778504	missense	probably damaging	0.98
R3982:Lrrk2	UTSW	15	91709284	missense	probably benign	0.22
R4125:Lrrk2	UTSW	15	91815483	missense	probably benign	0.01
R4130:Lrrk2	UTSW	15	91755794	missense	probably benign	0.19
R4296:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R4465:Lrrk2	UTSW	15	91747820	missense	probably damaging	0.96
R4478:Lrrk2	UTSW	15	91723188	missense	probably damaging	1.00
R4517:Lrrk2	UTSW	15	91705120	missense	probably benign
R4539:Lrrk2	UTSW	15	91729142	missense	possibly damaging	0.86
R4654:Lrrk2	UTSW	15	91765681	missense	probably damaging	0.96
R4710:Lrrk2	UTSW	15	91699927	missense	possibly damaging	0.88
R4722:Lrrk2	UTSW	15	91688901	missense	probably damaging	1.00
R4723:Lrrk2	UTSW	15	91764759	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91688849	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91765747	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91688849	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91765747	missense	probably damaging	1.00
R4787:Lrrk2	UTSW	15	91712828	missense	probably benign
R4945:Lrrk2	UTSW	15	91804920	missense	probably benign	0.02
R4948:Lrrk2	UTSW	15	91803389	missense	probably benign	0.20
R5000:Lrrk2	UTSW	15	91749878	missense	probably damaging	1.00
R5031:Lrrk2	UTSW	15	91700619	missense	possibly damaging	0.50
R5067:Lrrk2	UTSW	15	91765790	missense	probably benign	0.01
R5245:Lrrk2	UTSW	15	91796089	missense	probably damaging	1.00
R5341:Lrrk2	UTSW	15	91772858	missense	probably damaging	1.00
R5460:Lrrk2	UTSW	15	91814644	splice site	probably null
R5551:Lrrk2	UTSW	15	91812350	missense	probably benign
R5574:Lrrk2	UTSW	15	91787016	missense	probably damaging	1.00
R5577:Lrrk2	UTSW	15	91765745	missense	probably damaging	1.00
R5685:Lrrk2	UTSW	15	91803301	nonsense	probably null
R5712:Lrrk2	UTSW	15	91702222	nonsense	probably null
R5728:Lrrk2	UTSW	15	91774974	missense	probably benign	0.36
R5782:Lrrk2	UTSW	15	91702183	missense	probably damaging	1.00
R5788:Lrrk2	UTSW	15	91764648	missense	possibly damaging	0.55
R5821:Lrrk2	UTSW	15	91709390	critical splice donor site	probably null
R5852:Lrrk2	UTSW	15	91755949	missense	probably damaging	1.00
R5934:Lrrk2	UTSW	15	91734046	missense	probably benign	0.00
R5935:Lrrk2	UTSW	15	91745831	missense	probably benign	0.14
R5979:Lrrk2	UTSW	15	91772945	missense	possibly damaging	0.47
R6101:Lrrk2	UTSW	15	91723135	missense	probably benign	0.10
R6114:Lrrk2	UTSW	15	91747826	missense	probably benign	0.33
R6259:Lrrk2	UTSW	15	91702247	missense	probably benign	0.00
R6376:Lrrk2	UTSW	15	91742266	missense	possibly damaging	0.89
R6417:Lrrk2	UTSW	15	91812346	missense	probably benign	0.03
R6420:Lrrk2	UTSW	15	91812346	missense	probably benign	0.03
R6737:Lrrk2	UTSW	15	91723218	missense	possibly damaging	0.50
R7056:Lrrk2	UTSW	15	91774995	nonsense	probably null
R7072:Lrrk2	UTSW	15	91801920	missense	probably benign	0.03
R7109:Lrrk2	UTSW	15	91764782	missense	probably damaging	1.00
R7128:Lrrk2	UTSW	15	91801885	missense	probably benign
R7144:Lrrk2	UTSW	15	91734055	missense	possibly damaging	0.54
R7187:Lrrk2	UTSW	15	91757001	missense	possibly damaging	0.92
R7270:Lrrk2	UTSW	15	91700441	missense	probably benign	0.01
R7356:Lrrk2	UTSW	15	91738744	missense	probably benign	0.07
R7360:Lrrk2	UTSW	15	91731655	critical splice donor site	probably null
R7373:Lrrk2	UTSW	15	91700004	critical splice donor site	probably null
R7465:Lrrk2	UTSW	15	91767340	missense	probably damaging	1.00
R7477:Lrrk2	UTSW	15	91812325	missense	probably damaging	0.98
R7614:Lrrk2	UTSW	15	91772858	missense	probably damaging	1.00
R7622:Lrrk2	UTSW	15	91812323	missense	probably damaging	1.00
R7658:Lrrk2	UTSW	15	91700358	missense	possibly damaging	0.91
R7679:Lrrk2	UTSW	15	91726186	missense	possibly damaging	0.58
R7737:Lrrk2	UTSW	15	91815446	missense	probably damaging	0.98
R7739:Lrrk2	UTSW	15	91700613	missense	probably damaging	1.00
R7740:Lrrk2	UTSW	15	91767324	missense	probably damaging	1.00
R7908:Lrrk2	UTSW	15	91726152	missense	probably damaging	1.00
R8299:Lrrk2	UTSW	15	91673240	start gained	probably benign
R8389:Lrrk2	UTSW	15	91699991	missense	probably damaging	1.00
R8462:Lrrk2	UTSW	15	91731477	missense	probably benign
R8698:Lrrk2	UTSW	15	91752197	missense	probably benign	0.38
R9084:Lrrk2	UTSW	15	91750266	missense
R9086:Lrrk2	UTSW	15	91755848	missense	probably benign	0.01
R9096:Lrrk2	UTSW	15	91673256	start gained	probably benign
R9097:Lrrk2	UTSW	15	91673256	start gained	probably benign
R9267:Lrrk2	UTSW	15	91700426	missense	probably damaging	0.99
R9285:Lrrk2	UTSW	15	91778483	missense	probably damaging	1.00
R9341:Lrrk2	UTSW	15	91700415	missense	probably benign	0.18
R9343:Lrrk2	UTSW	15	91700415	missense	probably benign	0.18
R9371:Lrrk2	UTSW	15	91723204	missense	probably damaging	1.00
R9424:Lrrk2	UTSW	15	91752185	nonsense	probably null
R9489:Lrrk2	UTSW	15	91737217	missense	probably benign	0.37
R9502:Lrrk2	UTSW	15	91723162	missense	probably damaging	0.98
R9563:Lrrk2	UTSW	15	91749840	missense	possibly damaging	0.90
R9576:Lrrk2	UTSW	15	91752185	nonsense	probably null
R9605:Lrrk2	UTSW	15	91737217	missense	probably benign	0.37
R9635:Lrrk2	UTSW	15	91812324	missense	probably benign	0.21
R9641:Lrrk2	UTSW	15	91787048	missense	possibly damaging	0.94
R9660:Lrrk2	UTSW	15	91734025	missense	probably benign	0.00
R9673:Lrrk2	UTSW	15	91765681	missense	probably damaging	1.00
R9708:Lrrk2	UTSW	15	91750279	nonsense	probably null
R9728:Lrrk2	UTSW	15	91734025	missense	probably benign	0.00
R9757:Lrrk2	UTSW	15	91811026	missense	probably benign	0.03
RF001:Lrrk2	UTSW	15	91736633	missense	probably benign	0.11
X0028:Lrrk2	UTSW	15	91738851	missense	probably benign	0.00
Z1088:Lrrk2	UTSW	15	91726240	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TGGCATAGAGTGTGGCTTCC -3'
(R):5'- TGCCATAAATGAGCAGAAGTCC -3'

Sequencing Primer
(F):5'- CACTGCCTGTGCTGTTAGCG -3'
(R):5'- GCAGAAGTCCTGAGGAACATACAC -3'

Posted On

2021-08-31