Incidental Mutation 'R8947:Lrrk2'
ID 681413
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 4921513O20Rik, cI-46, D630001M17Rik, 9330188B09Rik, LOC381026
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 91557378-91700323 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 91586473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 430 (Q430*)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably null
Transcript: ENSMUST00000060642
AA Change: Q430*
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: Q430*

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91,632,002 (GRCm39) missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91,584,146 (GRCm39) missense probably benign
IGL00770:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00774:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00791:Lrrk2 APN 15 91,664,044 (GRCm39) missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91,639,993 (GRCm39) missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91,641,261 (GRCm39) missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91,623,035 (GRCm39) missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91,610,340 (GRCm39) missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91,567,345 (GRCm39) missense probably benign
IGL01301:Lrrk2 APN 15 91,651,542 (GRCm39) missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91,584,772 (GRCm39) splice site probably null
IGL01465:Lrrk2 APN 15 91,613,128 (GRCm39) missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91,696,516 (GRCm39) missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91,584,192 (GRCm39) missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91,659,191 (GRCm39) missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91,664,149 (GRCm39) missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91,615,694 (GRCm39) missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91,610,511 (GRCm39) critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91,570,025 (GRCm39) missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91,634,480 (GRCm39) missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91,631,958 (GRCm39) missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91,584,781 (GRCm39) missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91,681,617 (GRCm39) splice site probably null
horned UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
spree UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
Spur UTSW 15 91,659,198 (GRCm39) nonsense probably null
3-1:Lrrk2 UTSW 15 91,686,137 (GRCm39) missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91,651,542 (GRCm39) missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
H8786:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
IGL02835:Lrrk2 UTSW 15 91,698,863 (GRCm39) critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0078:Lrrk2 UTSW 15 91,618,212 (GRCm39) missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91,629,999 (GRCm39) missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91,662,617 (GRCm39) splice site probably benign
R0448:Lrrk2 UTSW 15 91,593,508 (GRCm39) missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91,634,478 (GRCm39) missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91,699,619 (GRCm39) missense probably benign
R0617:Lrrk2 UTSW 15 91,636,481 (GRCm39) missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91,680,231 (GRCm39) missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91,657,199 (GRCm39) missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91,641,273 (GRCm39) critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91,659,249 (GRCm39) splice site probably null
R0766:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91,640,165 (GRCm39) missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91,613,284 (GRCm39) missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91,613,372 (GRCm39) missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91,557,892 (GRCm39) missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91,584,671 (GRCm39) nonsense probably null
R1223:Lrrk2 UTSW 15 91,557,838 (GRCm39) missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91,696,563 (GRCm39) missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91,613,123 (GRCm39) missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91,618,261 (GRCm39) missense probably benign
R1773:Lrrk2 UTSW 15 91,664,184 (GRCm39) missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91,584,095 (GRCm39) missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91,567,337 (GRCm39) missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91,620,864 (GRCm39) splice site probably null
R2160:Lrrk2 UTSW 15 91,680,263 (GRCm39) missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91,648,919 (GRCm39) missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91,681,729 (GRCm39) splice site probably benign
R2516:Lrrk2 UTSW 15 91,640,130 (GRCm39) missense probably benign
R3110:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91,621,314 (GRCm39) missense probably benign
R3842:Lrrk2 UTSW 15 91,640,119 (GRCm39) missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91,631,904 (GRCm39) missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91,631,903 (GRCm39) missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91,651,664 (GRCm39) critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,596,983 (GRCm39) missense possibly damaging 0.69
R3982:Lrrk2 UTSW 15 91,593,487 (GRCm39) missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91,699,686 (GRCm39) missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91,639,997 (GRCm39) missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91,632,023 (GRCm39) missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91,607,391 (GRCm39) missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91,589,323 (GRCm39) missense probably benign
R4539:Lrrk2 UTSW 15 91,613,345 (GRCm39) missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91,573,104 (GRCm39) missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91,648,962 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91,597,031 (GRCm39) missense probably benign
R4945:Lrrk2 UTSW 15 91,689,123 (GRCm39) missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91,687,592 (GRCm39) missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91,634,081 (GRCm39) missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91,584,822 (GRCm39) missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91,649,993 (GRCm39) missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91,698,847 (GRCm39) splice site probably null
R5551:Lrrk2 UTSW 15 91,696,553 (GRCm39) missense probably benign
R5574:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91,649,948 (GRCm39) missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91,687,504 (GRCm39) nonsense probably null
R5712:Lrrk2 UTSW 15 91,586,425 (GRCm39) nonsense probably null
R5728:Lrrk2 UTSW 15 91,659,177 (GRCm39) missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91,586,386 (GRCm39) missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91,648,851 (GRCm39) missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91,593,593 (GRCm39) critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91,640,152 (GRCm39) missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91,618,249 (GRCm39) missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91,630,034 (GRCm39) missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91,657,148 (GRCm39) missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91,607,338 (GRCm39) missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91,632,029 (GRCm39) missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91,626,469 (GRCm39) missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91,607,421 (GRCm39) missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91,659,198 (GRCm39) nonsense probably null
R7072:Lrrk2 UTSW 15 91,686,123 (GRCm39) missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91,648,985 (GRCm39) missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91,686,088 (GRCm39) missense probably benign
R7144:Lrrk2 UTSW 15 91,618,258 (GRCm39) missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91,641,204 (GRCm39) missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91,584,644 (GRCm39) missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91,622,947 (GRCm39) missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91,615,858 (GRCm39) critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91,584,207 (GRCm39) critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91,651,543 (GRCm39) missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91,696,528 (GRCm39) missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91,696,526 (GRCm39) missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91,584,561 (GRCm39) missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91,610,389 (GRCm39) missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91,699,649 (GRCm39) missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91,584,816 (GRCm39) missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91,651,527 (GRCm39) missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91,610,355 (GRCm39) missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91,557,443 (GRCm39) start gained probably benign
R8389:Lrrk2 UTSW 15 91,584,194 (GRCm39) missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91,615,680 (GRCm39) missense probably benign
R8698:Lrrk2 UTSW 15 91,636,400 (GRCm39) missense probably benign 0.38
R9084:Lrrk2 UTSW 15 91,634,469 (GRCm39) missense
R9086:Lrrk2 UTSW 15 91,640,051 (GRCm39) missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9097:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9267:Lrrk2 UTSW 15 91,584,629 (GRCm39) missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91,662,686 (GRCm39) missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91,607,407 (GRCm39) missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9489:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91,607,365 (GRCm39) missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91,634,043 (GRCm39) missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9605:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91,696,527 (GRCm39) missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91,671,251 (GRCm39) missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91,634,482 (GRCm39) nonsense probably null
R9728:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91,695,229 (GRCm39) missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91,620,836 (GRCm39) missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91,623,054 (GRCm39) missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91,610,443 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGGCATAGAGTGTGGCTTCC -3'
(R):5'- TGCCATAAATGAGCAGAAGTCC -3'

Sequencing Primer
(F):5'- CACTGCCTGTGCTGTTAGCG -3'
(R):5'- GCAGAAGTCCTGAGGAACATACAC -3'
Posted On 2021-08-31