Incidental Mutation 'R8947:Lrrk2'
ID 681413
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Essential gene? Possibly essential (E-score: 0.576) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 91702270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 430 (Q430*)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably null
Transcript: ENSMUST00000060642
AA Change: Q430*
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: Q430*

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,097 S477T probably benign Het
4930562C15Rik T A 16: 4,847,428 F141L unknown Het
A2ml1 G T 6: 128,552,256 N974K probably damaging Het
Abcg8 T C 17: 84,691,818 L114P probably damaging Het
Akt3 A T 1: 177,131,079 W22R probably damaging Het
Ank2 C T 3: 126,942,747 probably benign Het
Ap1g1 C T 8: 109,863,332 probably benign Het
Arhgef19 T A 4: 141,246,307 V35E possibly damaging Het
Baz2b T C 2: 59,948,239 D759G probably benign Het
BC051665 C A 13: 60,782,190 G320W probably damaging Het
Bche T A 3: 73,701,428 T222S probably damaging Het
C8a T C 4: 104,822,129 D444G probably damaging Het
Cacna1e A T 1: 154,402,150 S2019T probably benign Het
Carm1 T C 9: 21,586,453 I373T probably damaging Het
Ccdc39 T C 3: 33,815,460 probably benign Het
Clic5 A T 17: 44,242,261 probably benign Het
Cntn3 A G 6: 102,437,903 F28L probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Cpb2 T C 14: 75,278,187 Y352H probably damaging Het
Cpeb3 A T 19: 37,174,966 D3E probably damaging Het
Ctsl T C 13: 64,367,026 T155A probably damaging Het
Cygb C T 11: 116,649,819 A114T probably damaging Het
Cyp11a1 T C 9: 58,017,455 V17A probably benign Het
Dhcr7 T G 7: 143,847,222 I374S probably damaging Het
Dhx36 T C 3: 62,472,966 R807G probably benign Het
Diaph1 A T 18: 37,853,701 V1077E probably damaging Het
Ehmt2 A G 17: 34,908,304 E131G possibly damaging Het
Evpl A G 11: 116,221,338 I1842T probably damaging Het
Fastk C A 5: 24,441,651 C294F probably damaging Het
Fndc5 T C 4: 129,137,136 C20R probably benign Het
Gm7298 C A 6: 121,780,594 Q1053K possibly damaging Het
Gm8362 A G 14: 6,773,326 probably null Het
Gmps T A 3: 63,998,677 I465N probably damaging Het
Heatr4 T G 12: 83,954,657 M904L probably benign Het
Hhip T A 8: 80,045,156 D175V probably damaging Het
Hmcn2 G A 2: 31,388,208 V1641M probably damaging Het
Hoxa5 T G 6: 52,202,796 T200P probably damaging Het
Ift122 C A 6: 115,924,407 A1050D probably benign Het
Igf2bp2 C A 16: 22,078,723 E247* probably null Het
Irak1bp1 T A 9: 82,846,793 L259H probably damaging Het
Irgm1 G A 11: 48,868,748 probably benign Het
Itih1 A T 14: 30,935,909 probably benign Het
Itpk1 A T 12: 102,570,323 C355S probably benign Het
Kcng4 T C 8: 119,625,713 E486G possibly damaging Het
Kif20b T C 19: 34,941,229 V671A possibly damaging Het
Kif28 T G 1: 179,716,755 I345L possibly damaging Het
Klri2 C G 6: 129,733,779 probably null Het
Kntc1 T C 5: 123,786,978 V1118A probably benign Het
Lpin2 T A 17: 71,204,876 I34N probably benign Het
Lrch3 T A 16: 32,981,829 V264D possibly damaging Het
Map10 T G 8: 125,671,100 S411A probably benign Het
Map1a A T 2: 121,304,969 I2089F probably benign Het
Med12l T A 3: 59,077,022 probably benign Het
Mypn T A 10: 63,169,377 Q317L probably damaging Het
Ncan T A 8: 70,102,521 I999F probably damaging Het
Nmrk2 C A 10: 81,199,705 R134L probably damaging Het
Olfr1290 C T 2: 111,489,697 V154I probably benign Het
Olfr181 T C 16: 58,926,070 N167S probably benign Het
Olfr5 A G 7: 6,480,247 V303A probably benign Het
Olfr583 T A 7: 103,052,108 V270E probably damaging Het
Olfr905 T A 9: 38,473,389 I214N probably damaging Het
Osbpl1a A G 18: 12,766,801 probably null Het
Pcdh1 T C 18: 38,199,020 D310G possibly damaging Het
Pkn2 C T 3: 142,811,913 probably null Het
Plch1 T A 3: 63,784,126 M31L probably damaging Het
Polg2 A G 11: 106,768,344 F448L probably damaging Het
Ppp4r3b A G 11: 29,200,758 T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 E558K probably damaging Het
Prdm9 T A 17: 15,544,008 I837F possibly damaging Het
R3hdm1 T A 1: 128,174,957 M125K possibly damaging Het
Rbm39 A T 2: 156,148,356 V468E probably damaging Het
Rnasel T A 1: 153,755,031 V431E probably damaging Het
Rps2 T A 17: 24,721,253 D220E probably benign Het
Rsf1 T C 7: 97,681,852 probably benign Het
Rsph10b G T 5: 143,977,134 A710S probably benign Het
Sez6 A T 11: 77,953,527 T59S probably damaging Het
Sf3b1 A T 1: 55,000,285 V727E probably damaging Het
Slit2 T G 5: 48,249,798 L857R probably damaging Het
Sspo T G 6: 48,448,570 C42G probably damaging Het
Strc C T 2: 121,370,989 D1245N probably benign Het
Supv3l1 T A 10: 62,432,339 T576S probably benign Het
Tecrl C T 5: 83,313,307 R101Q probably benign Het
Tmeff2 A G 1: 51,181,793 Y309C probably damaging Het
Tmem43 T A 6: 91,485,380 W316R probably damaging Het
Tmigd3 T C 3: 105,914,238 V141A probably benign Het
Trav9-1 T C 14: 53,488,127 F8L probably benign Het
Trbv5 T G 6: 41,062,707 F82C probably damaging Het
Ubtf T C 11: 102,314,976 N41S possibly damaging Het
Uggt1 T C 1: 36,158,148 T1225A probably benign Het
Vmn1r72 T C 7: 11,669,880 R214G possibly damaging Het
Vmn2r12 T G 5: 109,086,656 K563N possibly damaging Het
Vmn2r83 T C 10: 79,469,039 S28P probably benign Het
Vwa8 T G 14: 79,201,112 L1875R probably damaging Het
Xrcc6 T A 15: 82,029,665 V64E probably damaging Het
Zfp292 T C 4: 34,811,835 Y403C probably damaging Het
Zfp955a A T 17: 33,241,981 H392Q probably damaging Het
Zfyve19 T C 2: 119,210,809 S69P probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
R9267:Lrrk2 UTSW 15 91700426 missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91778483 missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91723204 missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91752185 nonsense probably null
R9489:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91723162 missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91749840 missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91752185 nonsense probably null
R9605:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91812324 missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91787048 missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91765681 missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91750279 nonsense probably null
R9728:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91811026 missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGGCATAGAGTGTGGCTTCC -3'
(R):5'- TGCCATAAATGAGCAGAAGTCC -3'

Sequencing Primer
(F):5'- CACTGCCTGTGCTGTTAGCG -3'
(R):5'- GCAGAAGTCCTGAGGAACATACAC -3'
Posted On 2021-08-31