Incidental Mutation 'R8947:4930562C15Rik'
ID 681414
Institutional Source Beutler Lab
Gene Symbol 4930562C15Rik
Ensembl Gene ENSMUSG00000022518
Gene Name RIKEN cDNA 4930562C15 gene
Synonyms
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 4653280-4685550 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4665292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 141 (F141L)
Ref Sequence ENSEMBL: ENSMUSP00000097784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100211]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000100211
AA Change: F141L
SMART Domains Protein: ENSMUSP00000097784
Gene: ENSMUSG00000022518
AA Change: F141L

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.54e-5 PROSPERO
internal_repeat_1 314 341 2.54e-5 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
Pfam:DUF4795 745 960 1.7e-46 PFAM
low complexity region 1095 1109 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in 4930562C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:4930562C15Rik APN 16 4,682,510 (GRCm39) missense probably benign 0.31
IGL01610:4930562C15Rik APN 16 4,669,429 (GRCm39) splice site probably benign
IGL02869:4930562C15Rik APN 16 4,685,323 (GRCm39) missense possibly damaging 0.68
IGL03242:4930562C15Rik APN 16 4,667,189 (GRCm39) missense unknown
R0063:4930562C15Rik UTSW 16 4,678,912 (GRCm39) nonsense probably null
R0063:4930562C15Rik UTSW 16 4,678,912 (GRCm39) nonsense probably null
R0083:4930562C15Rik UTSW 16 4,667,406 (GRCm39) missense unknown
R0565:4930562C15Rik UTSW 16 4,682,200 (GRCm39) missense probably benign 0.22
R0630:4930562C15Rik UTSW 16 4,668,803 (GRCm39) missense possibly damaging 0.90
R0734:4930562C15Rik UTSW 16 4,668,198 (GRCm39) missense probably benign 0.01
R1200:4930562C15Rik UTSW 16 4,667,536 (GRCm39) missense unknown
R1738:4930562C15Rik UTSW 16 4,682,475 (GRCm39) missense probably damaging 1.00
R1775:4930562C15Rik UTSW 16 4,669,422 (GRCm39) splice site probably null
R1945:4930562C15Rik UTSW 16 4,653,549 (GRCm39) missense unknown
R2132:4930562C15Rik UTSW 16 4,653,835 (GRCm39) missense unknown
R2445:4930562C15Rik UTSW 16 4,682,261 (GRCm39) splice site probably null
R2696:4930562C15Rik UTSW 16 4,668,228 (GRCm39) missense probably benign 0.04
R4729:4930562C15Rik UTSW 16 4,667,187 (GRCm39) missense unknown
R4779:4930562C15Rik UTSW 16 4,667,613 (GRCm39) missense unknown
R4806:4930562C15Rik UTSW 16 4,667,536 (GRCm39) missense unknown
R4808:4930562C15Rik UTSW 16 4,667,536 (GRCm39) missense unknown
R4876:4930562C15Rik UTSW 16 4,667,536 (GRCm39) missense unknown
R4931:4930562C15Rik UTSW 16 4,678,910 (GRCm39) missense possibly damaging 0.47
R4956:4930562C15Rik UTSW 16 4,672,816 (GRCm39) missense probably damaging 0.99
R5085:4930562C15Rik UTSW 16 4,653,837 (GRCm39) nonsense probably null
R5203:4930562C15Rik UTSW 16 4,653,462 (GRCm39) missense unknown
R5229:4930562C15Rik UTSW 16 4,667,915 (GRCm39) missense possibly damaging 0.73
R5461:4930562C15Rik UTSW 16 4,682,227 (GRCm39) missense probably damaging 1.00
R5462:4930562C15Rik UTSW 16 4,682,227 (GRCm39) missense probably damaging 1.00
R5464:4930562C15Rik UTSW 16 4,682,227 (GRCm39) missense probably damaging 1.00
R5595:4930562C15Rik UTSW 16 4,682,143 (GRCm39) missense probably benign 0.01
R6054:4930562C15Rik UTSW 16 4,653,729 (GRCm39) missense unknown
R6405:4930562C15Rik UTSW 16 4,669,742 (GRCm39) missense probably damaging 0.97
R6859:4930562C15Rik UTSW 16 4,669,799 (GRCm39) missense possibly damaging 0.86
R7124:4930562C15Rik UTSW 16 4,682,196 (GRCm39) missense probably benign 0.02
R7139:4930562C15Rik UTSW 16 4,668,048 (GRCm39) missense probably benign 0.00
R7182:4930562C15Rik UTSW 16 4,667,578 (GRCm39) missense unknown
R7219:4930562C15Rik UTSW 16 4,667,508 (GRCm39) missense unknown
R7366:4930562C15Rik UTSW 16 4,653,633 (GRCm39) missense unknown
R7592:4930562C15Rik UTSW 16 4,667,138 (GRCm39) missense unknown
R7759:4930562C15Rik UTSW 16 4,682,514 (GRCm39) missense probably benign 0.01
R7789:4930562C15Rik UTSW 16 4,682,175 (GRCm39) missense probably benign 0.01
R7873:4930562C15Rik UTSW 16 4,684,091 (GRCm39) missense probably benign
R7916:4930562C15Rik UTSW 16 4,682,454 (GRCm39) nonsense probably null
R8093:4930562C15Rik UTSW 16 4,669,368 (GRCm39) missense possibly damaging 0.86
R8169:4930562C15Rik UTSW 16 4,684,082 (GRCm39) missense probably benign 0.00
R8278:4930562C15Rik UTSW 16 4,668,040 (GRCm39) missense probably benign 0.33
R8372:4930562C15Rik UTSW 16 4,682,152 (GRCm39) missense probably damaging 0.99
R8493:4930562C15Rik UTSW 16 4,653,453 (GRCm39) start codon destroyed unknown
R8549:4930562C15Rik UTSW 16 4,681,061 (GRCm39) critical splice donor site probably null
R9137:4930562C15Rik UTSW 16 4,685,312 (GRCm39) missense probably benign
R9339:4930562C15Rik UTSW 16 4,667,521 (GRCm39) missense unknown
R9422:4930562C15Rik UTSW 16 4,667,153 (GRCm39) missense
R9561:4930562C15Rik UTSW 16 4,680,980 (GRCm39) missense possibly damaging 0.52
R9618:4930562C15Rik UTSW 16 4,667,418 (GRCm39) missense unknown
R9747:4930562C15Rik UTSW 16 4,668,711 (GRCm39) missense probably damaging 1.00
R9773:4930562C15Rik UTSW 16 4,668,057 (GRCm39) missense possibly damaging 0.86
X0028:4930562C15Rik UTSW 16 4,685,231 (GRCm39) missense possibly damaging 0.83
Z1176:4930562C15Rik UTSW 16 4,684,112 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AAGGAACTCTGTTGTGTGCC -3'
(R):5'- GCCTGAGGGATCACAGATAGTTC -3'

Sequencing Primer
(F):5'- GGAACTCTGTTGTGTGCCTTTCC -3'
(R):5'- GACAGGGCAAACAGTTTTCTAG -3'
Posted On 2021-08-31