Incidental Mutation 'R8947:Osbpl1a'
ID 681423
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Name oxysterol binding protein-like 1A
Synonyms G430090F17Rik, LOC328902
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 12888371-13074898 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12899858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119512] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000143077] [ENSMUST00000155650]
AlphaFold Q91XL9
Predicted Effect probably null
Transcript: ENSMUST00000074352
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117361
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119512
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121774
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143077
SMART Domains Protein: ENSMUSP00000122967
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 184 3.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155650
SMART Domains Protein: ENSMUSP00000120439
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 13 46 N/A INTRINSIC
Pfam:Oxysterol_BP 131 187 1.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12,890,683 (GRCm39) missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 13,038,132 (GRCm39) missense probably benign
IGL01450:Osbpl1a APN 18 13,004,152 (GRCm39) missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 13,066,638 (GRCm39) missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12,896,632 (GRCm39) missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12,889,271 (GRCm39) missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12,899,881 (GRCm39) missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12,974,370 (GRCm39) nonsense probably null
IGL02451:Osbpl1a APN 18 13,047,550 (GRCm39) splice site probably benign
IGL02490:Osbpl1a APN 18 13,015,341 (GRCm39) unclassified probably benign
IGL02884:Osbpl1a APN 18 12,952,635 (GRCm39) nonsense probably null
R0084:Osbpl1a UTSW 18 12,890,669 (GRCm39) missense probably benign 0.07
R0266:Osbpl1a UTSW 18 13,004,220 (GRCm39) splice site probably null
R0565:Osbpl1a UTSW 18 12,892,501 (GRCm39) missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 13,015,336 (GRCm39) critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12,890,747 (GRCm39) missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 13,015,251 (GRCm39) critical splice donor site probably null
R1464:Osbpl1a UTSW 18 13,047,615 (GRCm39) missense probably benign
R1464:Osbpl1a UTSW 18 13,047,615 (GRCm39) missense probably benign
R1475:Osbpl1a UTSW 18 12,890,737 (GRCm39) missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12,891,896 (GRCm39) missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12,921,373 (GRCm39) splice site probably null
R1930:Osbpl1a UTSW 18 13,038,251 (GRCm39) missense probably benign 0.04
R1931:Osbpl1a UTSW 18 13,038,251 (GRCm39) missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12,892,457 (GRCm39) missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 13,004,230 (GRCm39) missense probably benign 0.06
R2504:Osbpl1a UTSW 18 13,038,088 (GRCm39) missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12,899,956 (GRCm39) missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 13,004,129 (GRCm39) unclassified probably benign
R4306:Osbpl1a UTSW 18 12,952,652 (GRCm39) missense probably benign
R4835:Osbpl1a UTSW 18 12,901,593 (GRCm39) critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12,896,594 (GRCm39) missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12,895,697 (GRCm39) missense probably benign 0.12
R5224:Osbpl1a UTSW 18 13,066,753 (GRCm39) missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12,891,910 (GRCm39) missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 13,025,319 (GRCm39) missense probably benign 0.22
R5579:Osbpl1a UTSW 18 12,974,249 (GRCm39) missense probably damaging 1.00
R5833:Osbpl1a UTSW 18 12,921,419 (GRCm39) missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 13,038,138 (GRCm39) missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12,952,560 (GRCm39) critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12,952,560 (GRCm39) critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12,889,318 (GRCm39) missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12,889,281 (GRCm39) missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12,900,020 (GRCm39) missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12,974,310 (GRCm39) nonsense probably null
R7154:Osbpl1a UTSW 18 12,901,649 (GRCm39) missense probably benign 0.00
R7459:Osbpl1a UTSW 18 13,066,642 (GRCm39) missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 13,066,657 (GRCm39) missense probably benign 0.44
R7797:Osbpl1a UTSW 18 13,015,321 (GRCm39) missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 13,047,578 (GRCm39) missense probably benign 0.01
R8084:Osbpl1a UTSW 18 13,038,099 (GRCm39) missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12,901,643 (GRCm39) missense probably benign 0.02
R9069:Osbpl1a UTSW 18 13,002,074 (GRCm39) intron probably benign
R9085:Osbpl1a UTSW 18 13,062,093 (GRCm39) missense probably damaging 1.00
R9288:Osbpl1a UTSW 18 12,904,402 (GRCm39) missense probably damaging 1.00
R9443:Osbpl1a UTSW 18 13,031,244 (GRCm39) missense probably benign 0.00
R9517:Osbpl1a UTSW 18 13,042,965 (GRCm39) missense probably benign
R9600:Osbpl1a UTSW 18 13,015,277 (GRCm39) missense probably benign 0.00
R9658:Osbpl1a UTSW 18 12,889,269 (GRCm39) missense probably benign 0.05
R9694:Osbpl1a UTSW 18 12,952,565 (GRCm39) missense probably benign 0.03
X0027:Osbpl1a UTSW 18 12,892,560 (GRCm39) missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 13,039,980 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGCACCTACCTTAAGTGGATC -3'
(R):5'- GGGTTTAGGCTCATCTCAGAAC -3'

Sequencing Primer
(F):5'- GTGGATCCACACACATTAAACATC -3'
(R):5'- GTTTAGGCTCATCTCAGAACAGGTC -3'
Posted On 2021-08-31