Incidental Mutation 'R8947:Diaph1'
ID 681424
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Name diaphanous related formin 1
Synonyms p140mDia, Dia1, mDia1, D18Wsu154e, Diap1, Drf1
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37976654-38068529 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37986754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1077 (V1077E)
Ref Sequence ENSEMBL: ENSMUSP00000111297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
AlphaFold O08808
PDB Structure Crystal structure of the core FH2 domain of mouse mDia1 [X-RAY DIFFRACTION]
Crystal structure of mDIA1 GBD-FH3 in complex with RhoC-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of the N-terminal mDia1 Armadillo Repeat Region and Dimerisation Domain in complex with the mDia1 autoregulatory domain (DAD) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE DIMERIC REGULATORY DOMAIN OF MOUSE DIAPHANEOUS-RELATED FORMIN (DRF), MDIA1 [X-RAY DIFFRACTION]
Crystal structure of the autoinhibitory switch in Formin mDia1; the DID/DAD complex [X-RAY DIFFRACTION]
Mouse Profilin IIa in complex with a double repeat from the FH1 domain of mDia1 [X-RAY DIFFRACTION]
Crystal structure of MDIA1-TSH GBD-FH3 in complex with CDC42-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of complex between amino and carboxy terminal fragments of mDia1 [X-RAY DIFFRACTION]
Autoinhibited Formin mDia1 Structure [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025337
AA Change: V1086E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: V1086E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080033
AA Change: V1077E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: V1077E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115629
AA Change: V1042E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: V1042E

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115631
AA Change: V1042E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: V1042E

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115634
AA Change: V1077E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: V1077E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Ehmt2 A G 17: 35,127,280 (GRCm39) E131G possibly damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 38,026,401 (GRCm39) critical splice donor site probably null
IGL01432:Diaph1 APN 18 38,030,557 (GRCm39) missense unknown
IGL01646:Diaph1 APN 18 38,026,469 (GRCm39) critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37,989,241 (GRCm39) nonsense probably null
IGL01731:Diaph1 APN 18 37,986,762 (GRCm39) critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37,989,261 (GRCm39) missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 38,023,735 (GRCm39) missense unknown
IGL02258:Diaph1 APN 18 37,986,383 (GRCm39) missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37,986,653 (GRCm39) missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37,987,626 (GRCm39) missense possibly damaging 0.47
albatross UTSW 18 37,986,732 (GRCm39) nonsense probably null
cucamonga UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
damselfly UTSW 18 38,030,603 (GRCm39) nonsense probably null
devastator UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
fishnets UTSW 18 38,028,353 (GRCm39) critical splice acceptor site probably null
Guangzhou UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
saran UTSW 18 37,988,857 (GRCm39) missense probably damaging 1.00
seethrough UTSW 18 38,022,822 (GRCm39) missense probably damaging 1.00
sheer UTSW 18 38,029,146 (GRCm39) critical splice donor site probably benign
R0137:Diaph1 UTSW 18 38,024,902 (GRCm39) missense unknown
R0446:Diaph1 UTSW 18 37,986,643 (GRCm39) missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37,989,553 (GRCm39) missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 38,038,187 (GRCm39) missense unknown
R1532:Diaph1 UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
R1534:Diaph1 UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
R1535:Diaph1 UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
R1536:Diaph1 UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
R1537:Diaph1 UTSW 18 38,029,146 (GRCm39) critical splice donor site probably null
R1611:Diaph1 UTSW 18 38,033,755 (GRCm39) missense unknown
R1756:Diaph1 UTSW 18 37,987,626 (GRCm39) missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 38,024,071 (GRCm39) missense unknown
R1812:Diaph1 UTSW 18 38,024,071 (GRCm39) missense unknown
R2121:Diaph1 UTSW 18 38,029,442 (GRCm39) missense unknown
R3710:Diaph1 UTSW 18 37,978,537 (GRCm39) missense probably damaging 1.00
R3891:Diaph1 UTSW 18 38,033,691 (GRCm39) splice site probably benign
R3892:Diaph1 UTSW 18 38,033,691 (GRCm39) splice site probably benign
R4077:Diaph1 UTSW 18 37,986,636 (GRCm39) missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37,986,636 (GRCm39) missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37,986,604 (GRCm39) missense probably damaging 1.00
R4815:Diaph1 UTSW 18 38,028,256 (GRCm39) missense unknown
R5242:Diaph1 UTSW 18 37,984,688 (GRCm39) missense probably damaging 1.00
R5294:Diaph1 UTSW 18 38,030,633 (GRCm39) missense unknown
R5294:Diaph1 UTSW 18 38,030,603 (GRCm39) nonsense probably null
R5349:Diaph1 UTSW 18 38,024,125 (GRCm39) missense unknown
R5427:Diaph1 UTSW 18 38,023,648 (GRCm39) missense unknown
R5623:Diaph1 UTSW 18 38,029,146 (GRCm39) critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37,989,004 (GRCm39) missense probably damaging 1.00
R5730:Diaph1 UTSW 18 38,036,829 (GRCm39) missense unknown
R5767:Diaph1 UTSW 18 37,986,408 (GRCm39) missense probably damaging 1.00
R5925:Diaph1 UTSW 18 38,024,988 (GRCm39) missense unknown
R6151:Diaph1 UTSW 18 37,986,406 (GRCm39) missense probably damaging 1.00
R6823:Diaph1 UTSW 18 38,009,436 (GRCm39) splice site probably null
R6876:Diaph1 UTSW 18 38,029,426 (GRCm39) missense unknown
R6925:Diaph1 UTSW 18 37,986,732 (GRCm39) nonsense probably null
R6983:Diaph1 UTSW 18 38,022,822 (GRCm39) missense probably damaging 1.00
R7073:Diaph1 UTSW 18 38,022,867 (GRCm39) critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 38,022,829 (GRCm39) missense probably benign 0.26
R7400:Diaph1 UTSW 18 37,987,555 (GRCm39) missense probably damaging 1.00
R7497:Diaph1 UTSW 18 38,028,353 (GRCm39) critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 38,026,322 (GRCm39) splice site probably null
R7703:Diaph1 UTSW 18 38,023,862 (GRCm39) missense unknown
R7834:Diaph1 UTSW 18 37,986,762 (GRCm39) critical splice acceptor site probably benign
R8073:Diaph1 UTSW 18 38,024,850 (GRCm39) missense unknown
R8378:Diaph1 UTSW 18 38,025,006 (GRCm39) missense unknown
R8847:Diaph1 UTSW 18 37,987,590 (GRCm39) missense possibly damaging 0.71
R8990:Diaph1 UTSW 18 37,988,857 (GRCm39) missense probably damaging 1.00
R9059:Diaph1 UTSW 18 38,022,798 (GRCm39) missense possibly damaging 0.53
R9189:Diaph1 UTSW 18 38,024,162 (GRCm39) missense unknown
R9297:Diaph1 UTSW 18 38,022,828 (GRCm39) missense probably benign 0.26
R9438:Diaph1 UTSW 18 38,026,443 (GRCm39) missense unknown
R9439:Diaph1 UTSW 18 38,029,412 (GRCm39) critical splice donor site probably null
R9538:Diaph1 UTSW 18 37,986,470 (GRCm39) missense probably damaging 1.00
R9596:Diaph1 UTSW 18 38,024,111 (GRCm39) missense unknown
R9752:Diaph1 UTSW 18 38,036,124 (GRCm39) missense unknown
R9762:Diaph1 UTSW 18 37,987,589 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTAGCAGTTTCCCCTTGC -3'
(R):5'- ACCTGGGCCTGTTTCTTTAG -3'

Sequencing Primer
(F):5'- GTTTCCCCTTGCTCACCAAAAAC -3'
(R):5'- CAAAACAGGATTTCTCTGTGTAGCTC -3'
Posted On 2021-08-31