Incidental Mutation 'R8948:Stk32b'
ID 681443
Institutional Source Beutler Lab
Gene Symbol Stk32b
Ensembl Gene ENSMUSG00000029123
Gene Name serine/threonine kinase 32B
Synonyms YANK2, 2510009F08Rik, Stk32, STKG6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8948 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 37446825-37717171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37454997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 348 (N348K)
Ref Sequence ENSEMBL: ENSMUSP00000092432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094836]
AlphaFold Q9JJX8
Predicted Effect possibly damaging
Transcript: ENSMUST00000094836
AA Change: N348K

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092432
Gene: ENSMUSG00000029123
AA Change: N348K

DomainStartEndE-ValueType
S_TKc 23 283 1.18e-84 SMART
low complexity region 323 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine protein kinase. Serine-threonine kinases transfer phosphate molecules to the oxygen atoms of serine and threonine. A genomic deletion affecting this gene has been associated with Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,709,912 S506I probably damaging Het
Abat T C 16: 8,600,941 I102T possibly damaging Het
Abca9 T C 11: 110,163,380 probably null Het
Ago3 T C 4: 126,350,322 probably null Het
Akap1 G T 11: 88,844,273 A75E probably damaging Het
Atad2b C A 12: 4,991,012 A227E possibly damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Ccdc30 T C 4: 119,324,161 E601G probably benign Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cdkn3 C T 14: 46,767,323 P114L probably damaging Het
Col6a2 C T 10: 76,610,693 G352D probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Ctc1 T G 11: 69,026,349 Y110* probably null Het
D630023F18Rik T A 1: 65,108,740 N218I probably damaging Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Efcc1 A G 6: 87,751,786 T408A probably benign Het
Epas1 A G 17: 86,827,492 T518A probably benign Het
Ergic2 A T 6: 148,202,507 M84K probably damaging Het
Ergic3 T C 2: 156,011,240 V201A probably benign Het
Espn C A 4: 152,138,821 W258L probably damaging Het
Gm45337 A G 7: 142,144,080 S156P unknown Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Itga2 C T 13: 114,873,330 G363D probably damaging Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kif11 T A 19: 37,398,154 D387E probably damaging Het
Lrrn2 A C 1: 132,938,366 I390L probably benign Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Muc16 C T 9: 18,647,233 R2588K unknown Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Olfr847 A G 9: 19,374,966 I305T probably benign Het
Osbpl8 T C 10: 111,267,669 I178T probably damaging Het
Perp A T 10: 18,853,578 I86F possibly damaging Het
Plpp1 A T 13: 112,856,977 I149F probably damaging Het
Preb A G 5: 30,958,327 S220P probably damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Ror2 T A 13: 53,131,996 I73F possibly damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Rsbn1 A T 3: 103,961,514 H623L possibly damaging Het
Sap30 C A 8: 57,487,422 A49S possibly damaging Het
Sf3b3 T C 8: 110,823,443 T648A probably benign Het
Sh3pxd2a T C 19: 47,373,443 R83G probably damaging Het
Slc35e1 A T 8: 72,492,198 I130N probably damaging Het
Smchd1 C T 17: 71,436,772 R466Q probably damaging Het
Smgc C T 15: 91,838,362 probably benign Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Telo2 A G 17: 25,113,111 V161A probably benign Het
Tmed11 C T 5: 108,777,427 R173H probably damaging Het
Trappc6a G A 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Vsig10l A T 7: 43,468,199 I739F possibly damaging Het
Zfyve1 A C 12: 83,548,028 V730G probably benign Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Zmym4 C T 4: 126,864,267 R1498H probably damaging Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Stk32b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Stk32b APN 5 37499030 splice site probably benign
IGL02525:Stk32b APN 5 37531633 missense probably damaging 1.00
IGL02946:Stk32b APN 5 37531539 splice site probably benign
IGL03277:Stk32b APN 5 37628976 missense probably damaging 0.99
flank UTSW 5 37466781 missense probably damaging 1.00
H8441:Stk32b UTSW 5 37457234 missense probably damaging 1.00
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0601:Stk32b UTSW 5 37531566 missense probably damaging 1.00
R0879:Stk32b UTSW 5 37459596 splice site probably benign
R1812:Stk32b UTSW 5 37466758 missense probably damaging 1.00
R1882:Stk32b UTSW 5 37531687 missense possibly damaging 0.91
R1982:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R3899:Stk32b UTSW 5 37457154 missense probably damaging 1.00
R4724:Stk32b UTSW 5 37454934 critical splice donor site probably null
R4885:Stk32b UTSW 5 37466797 missense probably damaging 1.00
R5531:Stk32b UTSW 5 37459734 splice site probably null
R5629:Stk32b UTSW 5 37457232 missense probably damaging 1.00
R6042:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R6610:Stk32b UTSW 5 37448678 missense probably benign 0.04
R6864:Stk32b UTSW 5 37448805 splice site probably null
R6879:Stk32b UTSW 5 37490523 missense possibly damaging 0.77
R7186:Stk32b UTSW 5 37466781 missense probably damaging 1.00
R8317:Stk32b UTSW 5 37454975 missense probably damaging 0.99
R8676:Stk32b UTSW 5 37457159 missense probably benign 0.00
R8795:Stk32b UTSW 5 37649139 missense probably damaging 0.98
R9192:Stk32b UTSW 5 37629000 missense probably damaging 1.00
V1024:Stk32b UTSW 5 37457234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACAGAGTCCATGGATG -3'
(R):5'- ACTCAGAAGCACATTTGTCTGC -3'

Sequencing Primer
(F):5'- AGTTCTCTTTAAGGATTTGGTCTTG -3'
(R):5'- GTCTGCAGACATAATTGCTGAACC -3'
Posted On 2021-08-31