Incidental Mutation 'R8948:Dchs1'
ID 681453
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms 3110041P15Rik, C130033F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8948 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105752990-105787654 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105759005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1873 (H1873Q)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: H1873Q

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: H1873Q

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Meta Mutation Damage Score 0.1265 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,709,912 S506I probably damaging Het
Abat T C 16: 8,600,941 I102T possibly damaging Het
Abca9 T C 11: 110,163,380 probably null Het
Ago3 T C 4: 126,350,322 probably null Het
Akap1 G T 11: 88,844,273 A75E probably damaging Het
Atad2b C A 12: 4,991,012 A227E possibly damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Ccdc30 T C 4: 119,324,161 E601G probably benign Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cdkn3 C T 14: 46,767,323 P114L probably damaging Het
Col6a2 C T 10: 76,610,693 G352D probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Ctc1 T G 11: 69,026,349 Y110* probably null Het
D630023F18Rik T A 1: 65,108,740 N218I probably damaging Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Efcc1 A G 6: 87,751,786 T408A probably benign Het
Epas1 A G 17: 86,827,492 T518A probably benign Het
Ergic2 A T 6: 148,202,507 M84K probably damaging Het
Ergic3 T C 2: 156,011,240 V201A probably benign Het
Espn C A 4: 152,138,821 W258L probably damaging Het
Gm45337 A G 7: 142,144,080 S156P unknown Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Itga2 C T 13: 114,873,330 G363D probably damaging Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kif11 T A 19: 37,398,154 D387E probably damaging Het
Lrrn2 A C 1: 132,938,366 I390L probably benign Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Muc16 C T 9: 18,647,233 R2588K unknown Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Olfr847 A G 9: 19,374,966 I305T probably benign Het
Osbpl8 T C 10: 111,267,669 I178T probably damaging Het
Pak2 A T 16: 32,033,911 probably benign Het
Perp A T 10: 18,853,578 I86F possibly damaging Het
Plpp1 A T 13: 112,856,977 I149F probably damaging Het
Preb A G 5: 30,958,327 S220P probably damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Ror2 T A 13: 53,131,996 I73F possibly damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Rsbn1 A T 3: 103,961,514 H623L possibly damaging Het
Sap30 C A 8: 57,487,422 A49S possibly damaging Het
Sf3b3 T C 8: 110,823,443 T648A probably benign Het
Sh3pxd2a T C 19: 47,373,443 R83G probably damaging Het
Slc35e1 A T 8: 72,492,198 I130N probably damaging Het
Smchd1 C T 17: 71,436,772 R466Q probably damaging Het
Smgc C T 15: 91,838,362 probably benign Het
Stk32b A T 5: 37,454,997 N348K possibly damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Telo2 A G 17: 25,113,111 V161A probably benign Het
Tmed11 C T 5: 108,777,427 R173H probably damaging Het
Trappc6a G A 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Vsig10l A T 7: 43,468,199 I739F possibly damaging Het
Zfyve1 A C 12: 83,548,028 V730G probably benign Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Zmym4 C T 4: 126,864,267 R1498H probably damaging Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7834:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
R8076:Dchs1 UTSW 7 105755921 missense possibly damaging 0.52
R8076:Dchs1 UTSW 7 105761982 missense probably damaging 1.00
R8087:Dchs1 UTSW 7 105753499 missense probably benign 0.41
R8125:Dchs1 UTSW 7 105764882 missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105762617 missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105765511 missense probably benign 0.22
R8476:Dchs1 UTSW 7 105758808 missense probably benign 0.05
R8497:Dchs1 UTSW 7 105758961 missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105771738 missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105760857 missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105755390 missense probably benign 0.00
R8950:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R9029:Dchs1 UTSW 7 105753712 missense probably benign 0.13
R9039:Dchs1 UTSW 7 105756008 missense probably benign 0.11
R9081:Dchs1 UTSW 7 105754429 missense probably benign 0.00
R9134:Dchs1 UTSW 7 105755703 missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105765919 missense probably benign
R9162:Dchs1 UTSW 7 105765525 missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105772907 missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105755626 missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105753913 missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105766195 missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105765774 critical splice donor site probably null
R9392:Dchs1 UTSW 7 105772662 missense probably benign 0.09
R9619:Dchs1 UTSW 7 105764455 missense probably benign 0.07
R9680:Dchs1 UTSW 7 105762418 missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105757984 missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105763475 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATTGACGTCACGCACTG -3'
(R):5'- TTCCAGCTGCAGATAGAGGC -3'

Sequencing Primer
(F):5'- TACTGTGGTGCTCAGAGGCC -3'
(R):5'- CCAGAGATGGAGGCCAGC -3'
Posted On 2021-08-31