Incidental Mutation 'R8948:Olfr847'
ID 681459
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Name olfactory receptor 847
Synonyms MOR149-2, GA_x6K02T2PVTD-13113073-13112135
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R8948 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19373668-19378669 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19374966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 305 (I305T)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
AlphaFold Q8VFF4
Predicted Effect probably benign
Transcript: ENSMUST00000079620
AA Change: I305T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: I305T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216839
AA Change: I305T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,709,912 S506I probably damaging Het
Abat T C 16: 8,600,941 I102T possibly damaging Het
Abca9 T C 11: 110,163,380 probably null Het
Ago3 T C 4: 126,350,322 probably null Het
Akap1 G T 11: 88,844,273 A75E probably damaging Het
Atad2b C A 12: 4,991,012 A227E possibly damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Ccdc30 T C 4: 119,324,161 E601G probably benign Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cdkn3 C T 14: 46,767,323 P114L probably damaging Het
Col6a2 C T 10: 76,610,693 G352D probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Ctc1 T G 11: 69,026,349 Y110* probably null Het
D630023F18Rik T A 1: 65,108,740 N218I probably damaging Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Efcc1 A G 6: 87,751,786 T408A probably benign Het
Epas1 A G 17: 86,827,492 T518A probably benign Het
Ergic2 A T 6: 148,202,507 M84K probably damaging Het
Ergic3 T C 2: 156,011,240 V201A probably benign Het
Espn C A 4: 152,138,821 W258L probably damaging Het
Gm45337 A G 7: 142,144,080 S156P unknown Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Itga2 C T 13: 114,873,330 G363D probably damaging Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kif11 T A 19: 37,398,154 D387E probably damaging Het
Lrrn2 A C 1: 132,938,366 I390L probably benign Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Muc16 C T 9: 18,647,233 R2588K unknown Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Osbpl8 T C 10: 111,267,669 I178T probably damaging Het
Perp A T 10: 18,853,578 I86F possibly damaging Het
Plpp1 A T 13: 112,856,977 I149F probably damaging Het
Preb A G 5: 30,958,327 S220P probably damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Ror2 T A 13: 53,131,996 I73F possibly damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Rsbn1 A T 3: 103,961,514 H623L possibly damaging Het
Sap30 C A 8: 57,487,422 A49S possibly damaging Het
Sf3b3 T C 8: 110,823,443 T648A probably benign Het
Sh3pxd2a T C 19: 47,373,443 R83G probably damaging Het
Slc35e1 A T 8: 72,492,198 I130N probably damaging Het
Smchd1 C T 17: 71,436,772 R466Q probably damaging Het
Smgc C T 15: 91,838,362 probably benign Het
Stk32b A T 5: 37,454,997 N348K possibly damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Telo2 A G 17: 25,113,111 V161A probably benign Het
Tmed11 C T 5: 108,777,427 R173H probably damaging Het
Trappc6a G A 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Vsig10l A T 7: 43,468,199 I739F possibly damaging Het
Zfyve1 A C 12: 83,548,028 V730G probably benign Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Zmym4 C T 4: 126,864,267 R1498H probably damaging Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
R9326:Olfr847 UTSW 9 19375050 missense probably damaging 1.00
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTGGTCTCATGAGGAAATTAC -3'
(R):5'- ATCCTTATTCTATGGTGCAGCAG -3'

Sequencing Primer
(F):5'- CATGAGGAAATTACATTTGTGTGCTC -3'
(R):5'- CAGCAGTGGGAGTATACATCTGTTC -3'
Posted On 2021-08-31