Incidental Mutation 'R8948:Smchd1'
ID 681483
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms 4931400A14Rik, MommeD1
MMRRC Submission 068786-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.842) question?
Stock # R8948 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 71344489-71475343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71436772 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 466 (R466Q)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: R466Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: R466Q

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,709,912 S506I probably damaging Het
Abat T C 16: 8,600,941 I102T possibly damaging Het
Abca9 T C 11: 110,163,380 probably null Het
Ago3 T C 4: 126,350,322 probably null Het
Akap1 G T 11: 88,844,273 A75E probably damaging Het
Atad2b C A 12: 4,991,012 A227E possibly damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Ccdc30 T C 4: 119,324,161 E601G probably benign Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cdkn3 C T 14: 46,767,323 P114L probably damaging Het
Col6a2 C T 10: 76,610,693 G352D probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Ctc1 T G 11: 69,026,349 Y110* probably null Het
D630023F18Rik T A 1: 65,108,740 N218I probably damaging Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Efcc1 A G 6: 87,751,786 T408A probably benign Het
Epas1 A G 17: 86,827,492 T518A probably benign Het
Ergic2 A T 6: 148,202,507 M84K probably damaging Het
Ergic3 T C 2: 156,011,240 V201A probably benign Het
Espn C A 4: 152,138,821 W258L probably damaging Het
Gm45337 A G 7: 142,144,080 S156P unknown Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Itga2 C T 13: 114,873,330 G363D probably damaging Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kif11 T A 19: 37,398,154 D387E probably damaging Het
Lrrn2 A C 1: 132,938,366 I390L probably benign Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Muc16 C T 9: 18,647,233 R2588K unknown Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Olfr847 A G 9: 19,374,966 I305T probably benign Het
Osbpl8 T C 10: 111,267,669 I178T probably damaging Het
Pak2 A T 16: 32,033,911 probably benign Het
Perp A T 10: 18,853,578 I86F possibly damaging Het
Plpp1 A T 13: 112,856,977 I149F probably damaging Het
Preb A G 5: 30,958,327 S220P probably damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Ror2 T A 13: 53,131,996 I73F possibly damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Rsbn1 A T 3: 103,961,514 H623L possibly damaging Het
Sap30 C A 8: 57,487,422 A49S possibly damaging Het
Sf3b3 T C 8: 110,823,443 T648A probably benign Het
Sh3pxd2a T C 19: 47,373,443 R83G probably damaging Het
Slc35e1 A T 8: 72,492,198 I130N probably damaging Het
Smgc C T 15: 91,838,362 probably benign Het
Stk32b A T 5: 37,454,997 N348K possibly damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Telo2 A G 17: 25,113,111 V161A probably benign Het
Tmed11 C T 5: 108,777,427 R173H probably damaging Het
Trappc6a G A 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Vsig10l A T 7: 43,468,199 I739F possibly damaging Het
Zfyve1 A C 12: 83,548,028 V730G probably benign Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Zmym4 C T 4: 126,864,267 R1498H probably damaging Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
Dry_tortugas UTSW 17 71440956 missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71475301 start gained probably benign
R7898:Smchd1 UTSW 17 71377818 splice site probably null
R7965:Smchd1 UTSW 17 71455626 missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71390453 missense probably benign 0.28
R8359:Smchd1 UTSW 17 71431243 missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71394913 missense probably benign 0.22
R8426:Smchd1 UTSW 17 71448603 missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71407249 missense probably benign 0.18
R8954:Smchd1 UTSW 17 71448757 missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71394715 critical splice donor site probably null
R9054:Smchd1 UTSW 17 71363022 nonsense probably null
R9141:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9169:Smchd1 UTSW 17 71415664 missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71365089 missense probably benign 0.05
R9368:Smchd1 UTSW 17 71387076 missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71411848 missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71394796 missense probably benign 0.27
R9426:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9491:Smchd1 UTSW 17 71360025 critical splice donor site probably null
R9511:Smchd1 UTSW 17 71443904 missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTCTGTGTCTCTGCACC -3'
(R):5'- TGCATTTCTCTGAGGCCAC -3'

Sequencing Primer
(F):5'- CTGTGTCTCTGCACCTGTGTG -3'
(R):5'- CTTCAGTGTGCCCTTACAGAAATTG -3'
Posted On 2021-08-31