Mutagenetix > Incidental Mutation

Incidental Mutation 'R0734:Sec63'

68149

Institutional Source

Beutler Lab

Gene Symbol

Sec63

Ensembl Gene

ENSMUSG00000019802

Gene Name

SEC63-like (S. cerevisiae)

Synonyms

MMRRC Submission

038915-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0734 (G1)

Quality Score

110

Status

Validated

Chromosome

Chromosomal Location

42761496-42832514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42796208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 173 (T173A)

Ref Sequence

ENSEMBL: ENSMUSP00000019937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019937]

AlphaFold

Q8VHE0

Predicted Effect

probably benign
Transcript: ENSMUST00000019937
AA Change: T173A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802
AA Change: T173A

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
transmembrane domain	69	91	N/A	INTRINSIC
DnaJ	103	157	6.14e-23	SMART
Blast:Sec63	170	208	9e-6	BLAST
Sec63	219	714	6.98e-10	SMART
low complexity region	734	760	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155410

Meta Mutation Damage Score

0.1109

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.0%
20x: 93.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,850,334	S530T	probably benign	Het
Acer2	G	T	4: 86,917,559	K223N	probably benign	Het
Adam19	T	G	11: 46,127,403	C431G	probably damaging	Het
Adamts16	T	G	13: 70,738,481		probably benign	Het
Aox2	A	T	1: 58,305,341	E531V	probably benign	Het
Apaf1	A	T	10: 91,037,021	N720K	probably benign	Het
Atrnl1	T	A	19: 57,654,861	W394R	probably damaging	Het
Bcl6	T	C	16: 23,968,139	E634G	probably damaging	Het
Cfap65	T	A	1: 74,918,887	Y954F	probably damaging	Het
Cobl	A	G	11: 12,375,971	V168A	probably damaging	Het
Cped1	C	T	6: 22,085,041	P210S	probably damaging	Het
Crb1	C	T	1: 139,337,084	V199M	probably benign	Het
Cyp2j6	A	T	4: 96,523,844		probably benign	Het
Dhrs3	C	G	4: 144,927,176	S289W	probably damaging	Het
Dido1	T	G	2: 180,660,042	Q2023P	probably benign	Het
Dlg4	G	A	11: 70,042,705	G550R	probably damaging	Het
Dnah12	C	A	14: 26,800,013	H1928N	probably benign	Het
Dthd1	A	C	5: 62,839,410		probably benign	Het
Erg	C	A	16: 95,370,025	G269C	possibly damaging	Het
Erich6	G	A	3: 58,629,388		probably benign	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fancc	T	C	13: 63,331,842	R300G	probably damaging	Het
Fcer1g	T	A	1: 171,231,179	K47*	probably null	Het
Flt4	A	G	11: 49,626,717	T289A	possibly damaging	Het
Gcnt2	T	A	13: 40,860,521	F56Y	probably benign	Het
Gpatch8	G	T	11: 102,481,400	S437R	unknown	Het
Grin2a	T	A	16: 9,579,611	I871F	possibly damaging	Het
Hsd17b4	T	C	18: 50,170,777	V439A	possibly damaging	Het
Hykk	A	T	9: 54,946,432	K346M	possibly damaging	Het
Ifi208	T	C	1: 173,683,335	L352S	probably damaging	Het
Ikzf1	T	C	11: 11,758,195	V110A	probably damaging	Het
Irak3	A	T	10: 120,145,637		probably benign	Het
Lamp5	T	A	2: 136,059,030	V50E	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrch3	C	T	16: 32,997,483	R570*	probably null	Het
Map1lc3a	T	C	2: 155,276,976	V20A	possibly damaging	Het
Map3k14	C	A	11: 103,227,000	K655N	probably benign	Het
Mark2	A	G	19: 7,285,981		probably benign	Het
Mbtd1	G	A	11: 93,923,146	G205D	probably damaging	Het
Med13	T	C	11: 86,301,237	T861A	probably benign	Het
Meltf	T	A	16: 31,881,958	Y99N	probably damaging	Het
Mex3d	G	A	10: 80,381,532	T617I	possibly damaging	Het
Muc13	G	A	16: 33,803,082	V249I	probably damaging	Het
Myo18a	C	A	11: 77,847,404	P1688Q	probably damaging	Het
Naaladl1	A	T	19: 6,112,874		probably null	Het
Ncoa3	T	A	2: 166,069,191		probably benign	Het
Nf2	T	C	11: 4,820,409	T67A	probably benign	Het
Nin	A	G	12: 70,030,113	V1056A	probably benign	Het
Olfr1426	T	A	19: 12,088,119	R224S	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr59	A	T	11: 74,288,946	Q100L	probably damaging	Het
P3h1	T	C	4: 119,238,688	L331P	probably damaging	Het
Pabpc4l	T	C	3: 46,446,973	K79E	possibly damaging	Het
Pam	T	A	1: 97,864,362	R445*	probably null	Het
Pcdhb6	T	C	18: 37,335,334	I436T	probably damaging	Het
Piezo2	A	G	18: 63,041,723	Y1987H	probably damaging	Het
Plch2	G	A	4: 154,996,283	T477I	probably damaging	Het
Postn	G	A	3: 54,362,715	G72R	probably damaging	Het
Proca1	G	A	11: 78,201,802		probably benign	Het
Psip1	T	A	4: 83,463,588		probably benign	Het
Ptprd	G	A	4: 76,140,597	P153L	probably damaging	Het
Rgl1	T	C	1: 152,554,300	D242G	probably damaging	Het
Ric1	T	A	19: 29,594,818	I671K	possibly damaging	Het
Rxrg	T	A	1: 167,627,444	C199S	probably damaging	Het
Sec24c	A	C	14: 20,693,745	D1006A	probably damaging	Het
Sfxn5	T	C	6: 85,267,865		probably benign	Het
Spam1	A	G	6: 24,796,949	I300V	probably benign	Het
Spem1	A	G	11: 69,821,271	L189P	probably damaging	Het
Sptbn2	A	T	19: 4,748,123	R1959*	probably null	Het
Timeless	C	T	10: 128,250,060	R935W	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim24	T	C	6: 37,919,465	Y286H	possibly damaging	Het
Ttyh2	A	G	11: 114,710,193		probably benign	Het
Zbtb21	C	T	16: 97,952,627	C180Y	probably damaging	Het
Zfp746	T	C	6: 48,064,899	T298A	probably damaging	Het

Other mutations in Sec63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Sec63	APN	10	42812457	missense	possibly damaging	0.56
IGL02111:Sec63	APN	10	42810888	missense	probably damaging	1.00
IGL02457:Sec63	APN	10	42801733	splice site	probably benign
IGL02613:Sec63	APN	10	42801707	missense	probably damaging	1.00
IGL03002:Sec63	APN	10	42810909	missense	possibly damaging	0.51
IGL03493:Sec63	APN	10	42828941	missense	probably benign	0.06
cyst	UTSW	10	42828865	splice site	probably null
stillwater	UTSW	10	42803905	missense	probably damaging	1.00
R0233:Sec63	UTSW	10	42823908	missense	possibly damaging	0.48
R0233:Sec63	UTSW	10	42823908	missense	possibly damaging	0.48
R0234:Sec63	UTSW	10	42798798	missense	probably damaging	0.98
R0234:Sec63	UTSW	10	42798798	missense	probably damaging	0.98
R0538:Sec63	UTSW	10	42798799	missense	probably benign	0.01
R0906:Sec63	UTSW	10	42801928	missense	probably damaging	0.98
R1136:Sec63	UTSW	10	42806546	missense	probably damaging	1.00
R1665:Sec63	UTSW	10	42798728	splice site	probably null
R1736:Sec63	UTSW	10	42827918	nonsense	probably null
R1961:Sec63	UTSW	10	42823886	missense	probably damaging	1.00
R2696:Sec63	UTSW	10	42783526	missense	probably benign	0.05
R4886:Sec63	UTSW	10	42789393	nonsense	probably null
R4908:Sec63	UTSW	10	42805190	missense	probably damaging	0.99
R5174:Sec63	UTSW	10	42829081	utr 3 prime	probably benign
R5619:Sec63	UTSW	10	42789382	missense	probably damaging	1.00
R5766:Sec63	UTSW	10	42801681	missense	probably damaging	0.99
R5820:Sec63	UTSW	10	42796245	missense	possibly damaging	0.49
R6232:Sec63	UTSW	10	42828865	splice site	probably null
R6656:Sec63	UTSW	10	42816383	nonsense	probably null
R6847:Sec63	UTSW	10	42791253	missense	probably damaging	1.00
R6971:Sec63	UTSW	10	42783442	missense	probably damaging	1.00
R8037:Sec63	UTSW	10	42783487	missense	probably benign	0.00
R8529:Sec63	UTSW	10	42789383	missense	probably damaging	1.00
R8756:Sec63	UTSW	10	42810909	missense	possibly damaging	0.51
R9259:Sec63	UTSW	10	42823941	missense	probably benign	0.11
R9391:Sec63	UTSW	10	42805105	missense	probably benign	0.01
R9419:Sec63	UTSW	10	42803905	missense	probably damaging	1.00
R9760:Sec63	UTSW	10	42828948	missense	probably benign	0.00
RF010:Sec63	UTSW	10	42806624	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- acctttttctccatagacataGCATTTGCAT -3'
(R):5'- GTTCTCAAGCCAAAAGTAAGACACTATCCA -3'

Sequencing Primer
(F):5'- tgcagtgatcctcatgcc -3'
(R):5'- GCCAGCAGTATAATAATGGAACC -3'

Posted On

2013-09-03