Incidental Mutation 'R8949:Ttll4'
ID 681492
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R8949 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74661745-74703730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74681816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 547 (I547T)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect probably damaging
Transcript: ENSMUST00000042125
AA Change: I547T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I547T

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113678
AA Change: I547T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I547T

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141119
AA Change: I99T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257
AA Change: I99T

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,287,919 F3086L probably benign Het
Afm T A 5: 90,531,515 C289* probably null Het
Agpat3 A G 10: 78,283,155 Y202H probably benign Het
Atg4b T A 1: 93,787,757 *394R probably null Het
Atxn2l A T 7: 126,492,205 H1037Q probably damaging Het
Baz1a T C 12: 54,894,453 Y1504C probably damaging Het
Bfsp2 T C 9: 103,449,953 N195S probably benign Het
Bmpr1b T G 3: 141,880,442 S20R possibly damaging Het
Bmpr2 C T 1: 59,867,701 P651L possibly damaging Het
Cfh G T 1: 140,098,967 D549E probably damaging Het
Cndp2 A G 18: 84,675,005 L210P probably damaging Het
Col12a1 C A 9: 79,674,688 R1427L probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
D230025D16Rik T A 8: 105,249,443 I344K probably benign Het
Dhx32 A T 7: 133,742,741 Y46* probably null Het
Dnah9 A G 11: 66,168,400 L23P possibly damaging Het
Eef2 T A 10: 81,178,684 V135E probably damaging Het
Eef2k A T 7: 120,891,988 I2F probably damaging Het
Gm10354 C T 5: 14,976,198 probably null Het
Gzmg C T 14: 56,159,469 probably null Het
Hr T C 14: 70,557,888 I320T probably benign Het
Hs3st2 A G 7: 121,500,794 I288V probably benign Het
Ighv1-31 T C 12: 114,829,416 I67V probably benign Het
Krtap6-2 T C 16: 89,419,815 Y88C unknown Het
Ksr2 T C 5: 117,685,495 C446R possibly damaging Het
Lct A T 1: 128,294,192 W1537R probably damaging Het
Lrp1 T A 10: 127,589,536 probably benign Het
Map3k13 A G 16: 21,905,132 H288R probably benign Het
Mettl25 A G 10: 105,832,853 V136A probably benign Het
Muc16 A G 9: 18,520,925 probably null Het
Ndufv3 A G 17: 31,527,768 K211E possibly damaging Het
Nudcd1 T C 15: 44,388,575 E396G probably benign Het
Olfr1279 T A 2: 111,307,034 F276L probably damaging Het
Olfr1457 A T 19: 13,095,126 M1K probably null Het
Olfr622 A T 7: 103,639,495 I215K probably damaging Het
Sgsm3 A G 15: 81,010,411 Y544C probably damaging Het
Sirt1 T C 10: 63,326,185 E307G probably damaging Het
Skint6 T A 4: 113,074,099 Q498H probably benign Het
Smpdl3b T C 4: 132,746,503 K84E probably benign Het
Spcs2 A G 7: 99,844,716 S186P probably benign Het
Steap1 A T 5: 5,739,940 D24E probably damaging Het
Svep1 T C 4: 58,054,604 E3328G possibly damaging Het
Syt17 A G 7: 118,433,831 probably null Het
Tdpoz3 T C 3: 93,827,092 V358A probably benign Het
Tecrl C T 5: 83,313,307 R101Q probably benign Het
Tmem184a C A 5: 139,805,556 A426S probably benign Het
Tnc T C 4: 64,008,850 D813G probably damaging Het
Top1 A G 2: 160,705,262 T419A possibly damaging Het
Vmn1r193 T C 13: 22,219,750 D24G possibly damaging Het
Wfs1 C T 5: 36,966,943 R792H probably damaging Het
Zfp607a A G 7: 27,878,519 D338G possibly damaging Het
Zfp949 C T 9: 88,568,718 R114C possibly damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 splice site probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 splice site probably null
R2876:Ttll4 UTSW 1 74686438 splice site probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74679413 missense probably benign 0.00
R7837:Ttll4 UTSW 1 74681757 critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74696473 missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74679230 missense probably benign 0.02
R8115:Ttll4 UTSW 1 74687330 nonsense probably null
R9145:Ttll4 UTSW 1 74679790 missense probably benign 0.02
R9156:Ttll4 UTSW 1 74680066 missense probably benign 0.00
R9329:Ttll4 UTSW 1 74685962 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCCATCAAGAAGGGCAGTG -3'
(R):5'- TCAGTATCTCTTGACATAGCATTCC -3'

Sequencing Primer
(F):5'- CAGTGCTCGTGATGCTCAGTAC -3'
(R):5'- GCCTGATCTACATAGTGAGTTCCAG -3'
Posted On 2021-08-31