Incidental Mutation 'R8949:Skint6'
ID 681502
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 068787-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8949 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112931296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 498 (Q498H)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: Q498H

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: Q498H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: Q498H

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: Q498H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm T A 5: 90,679,374 (GRCm39) C289* probably null Het
Agpat3 A G 10: 78,118,989 (GRCm39) Y202H probably benign Het
Atg4b T A 1: 93,715,479 (GRCm39) *394R probably null Het
Atxn2l A T 7: 126,091,377 (GRCm39) H1037Q probably damaging Het
Baz1a T C 12: 54,941,238 (GRCm39) Y1504C probably damaging Het
Bfsp2 T C 9: 103,327,152 (GRCm39) N195S probably benign Het
Bmpr1b T G 3: 141,586,203 (GRCm39) S20R possibly damaging Het
Bmpr2 C T 1: 59,906,860 (GRCm39) P651L possibly damaging Het
Cfh G T 1: 140,026,705 (GRCm39) D549E probably damaging Het
Cndp2 A G 18: 84,693,130 (GRCm39) L210P probably damaging Het
Col12a1 C A 9: 79,581,970 (GRCm39) R1427L probably benign Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Dhx32 A T 7: 133,344,470 (GRCm39) Y46* probably null Het
Dnah9 A G 11: 66,059,226 (GRCm39) L23P possibly damaging Het
Eef2 T A 10: 81,014,518 (GRCm39) V135E probably damaging Het
Eef2k A T 7: 120,491,211 (GRCm39) I2F probably damaging Het
Gzmg C T 14: 56,396,926 (GRCm39) probably null Het
Hr T C 14: 70,795,328 (GRCm39) I320T probably benign Het
Hs3st2 A G 7: 121,100,017 (GRCm39) I288V probably benign Het
Ighv1-31 T C 12: 114,793,036 (GRCm39) I67V probably benign Het
Krtap6-2 T C 16: 89,216,703 (GRCm39) Y88C unknown Het
Ksr2 T C 5: 117,823,560 (GRCm39) C446R possibly damaging Het
Lct A T 1: 128,221,929 (GRCm39) W1537R probably damaging Het
Lrp1 T A 10: 127,425,405 (GRCm39) probably benign Het
Map3k13 A G 16: 21,723,882 (GRCm39) H288R probably benign Het
Mettl25 A G 10: 105,668,714 (GRCm39) V136A probably benign Het
Muc16 A G 9: 18,432,221 (GRCm39) probably null Het
Ndufv3 A G 17: 31,746,742 (GRCm39) K211E possibly damaging Het
Nkiras2 A T 11: 100,510,158 (GRCm39) probably benign Het
Nudcd1 T C 15: 44,251,971 (GRCm39) E396G probably benign Het
Or4g16 T A 2: 111,137,379 (GRCm39) F276L probably damaging Het
Or52a33 A T 7: 103,288,702 (GRCm39) I215K probably damaging Het
Or5b104 A T 19: 13,072,490 (GRCm39) M1K probably null Het
Phaf1 T A 8: 105,976,075 (GRCm39) I344K probably benign Het
Sgk3 A G 1: 9,938,699 (GRCm39) probably benign Het
Sgsm3 A G 15: 80,894,612 (GRCm39) Y544C probably damaging Het
Sirt1 T C 10: 63,161,964 (GRCm39) E307G probably damaging Het
Smpdl3b T C 4: 132,473,814 (GRCm39) K84E probably benign Het
Spata31h1 A G 10: 82,123,753 (GRCm39) F3086L probably benign Het
Spcs2 A G 7: 99,493,923 (GRCm39) S186P probably benign Het
Speer4e2 C T 5: 15,026,212 (GRCm39) probably null Het
Steap1 A T 5: 5,789,940 (GRCm39) D24E probably damaging Het
Svep1 T C 4: 58,054,604 (GRCm39) E3328G possibly damaging Het
Syt17 A G 7: 118,033,054 (GRCm39) probably null Het
Tdpoz3 T C 3: 93,734,399 (GRCm39) V358A probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmem184a C A 5: 139,791,311 (GRCm39) A426S probably benign Het
Tnc T C 4: 63,927,087 (GRCm39) D813G probably damaging Het
Top1 A G 2: 160,547,182 (GRCm39) T419A possibly damaging Het
Ttll4 T C 1: 74,720,975 (GRCm39) I547T probably damaging Het
Vmn1r193 T C 13: 22,403,920 (GRCm39) D24G possibly damaging Het
Wfs1 C T 5: 37,124,287 (GRCm39) R792H probably damaging Het
Zfp607a A G 7: 27,577,944 (GRCm39) D338G possibly damaging Het
Zfp949 C T 9: 88,450,771 (GRCm39) R114C possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTTGGCCTAGGATCAAGAAGG -3'
(R):5'- GAGCCCAGCATTTCTTCCTG -3'

Sequencing Primer
(F):5'- AAACACTCTTGTTCGTTCACCTTAAC -3'
(R):5'- CCAGCATTTCTTCCTGAGATAGAAC -3'
Posted On 2021-08-31