Incidental Mutation 'R8949:Syt17'
ID 681514
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission 068787-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8949 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 117979940-118047445 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 118033054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
AlphaFold Q920M7
Predicted Effect probably null
Transcript: ENSMUST00000081574
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
Predicted Effect probably benign
Transcript: ENSMUST00000203485
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm T A 5: 90,679,374 (GRCm39) C289* probably null Het
Agpat3 A G 10: 78,118,989 (GRCm39) Y202H probably benign Het
Atg4b T A 1: 93,715,479 (GRCm39) *394R probably null Het
Atxn2l A T 7: 126,091,377 (GRCm39) H1037Q probably damaging Het
Baz1a T C 12: 54,941,238 (GRCm39) Y1504C probably damaging Het
Bfsp2 T C 9: 103,327,152 (GRCm39) N195S probably benign Het
Bmpr1b T G 3: 141,586,203 (GRCm39) S20R possibly damaging Het
Bmpr2 C T 1: 59,906,860 (GRCm39) P651L possibly damaging Het
Cfh G T 1: 140,026,705 (GRCm39) D549E probably damaging Het
Cndp2 A G 18: 84,693,130 (GRCm39) L210P probably damaging Het
Col12a1 C A 9: 79,581,970 (GRCm39) R1427L probably benign Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Dhx32 A T 7: 133,344,470 (GRCm39) Y46* probably null Het
Dnah9 A G 11: 66,059,226 (GRCm39) L23P possibly damaging Het
Eef2 T A 10: 81,014,518 (GRCm39) V135E probably damaging Het
Eef2k A T 7: 120,491,211 (GRCm39) I2F probably damaging Het
Gzmg C T 14: 56,396,926 (GRCm39) probably null Het
Hr T C 14: 70,795,328 (GRCm39) I320T probably benign Het
Hs3st2 A G 7: 121,100,017 (GRCm39) I288V probably benign Het
Ighv1-31 T C 12: 114,793,036 (GRCm39) I67V probably benign Het
Krtap6-2 T C 16: 89,216,703 (GRCm39) Y88C unknown Het
Ksr2 T C 5: 117,823,560 (GRCm39) C446R possibly damaging Het
Lct A T 1: 128,221,929 (GRCm39) W1537R probably damaging Het
Lrp1 T A 10: 127,425,405 (GRCm39) probably benign Het
Map3k13 A G 16: 21,723,882 (GRCm39) H288R probably benign Het
Mettl25 A G 10: 105,668,714 (GRCm39) V136A probably benign Het
Muc16 A G 9: 18,432,221 (GRCm39) probably null Het
Ndufv3 A G 17: 31,746,742 (GRCm39) K211E possibly damaging Het
Nkiras2 A T 11: 100,510,158 (GRCm39) probably benign Het
Nudcd1 T C 15: 44,251,971 (GRCm39) E396G probably benign Het
Or4g16 T A 2: 111,137,379 (GRCm39) F276L probably damaging Het
Or52a33 A T 7: 103,288,702 (GRCm39) I215K probably damaging Het
Or5b104 A T 19: 13,072,490 (GRCm39) M1K probably null Het
Phaf1 T A 8: 105,976,075 (GRCm39) I344K probably benign Het
Sgk3 A G 1: 9,938,699 (GRCm39) probably benign Het
Sgsm3 A G 15: 80,894,612 (GRCm39) Y544C probably damaging Het
Sirt1 T C 10: 63,161,964 (GRCm39) E307G probably damaging Het
Skint6 T A 4: 112,931,296 (GRCm39) Q498H probably benign Het
Smpdl3b T C 4: 132,473,814 (GRCm39) K84E probably benign Het
Spata31h1 A G 10: 82,123,753 (GRCm39) F3086L probably benign Het
Spcs2 A G 7: 99,493,923 (GRCm39) S186P probably benign Het
Speer4e2 C T 5: 15,026,212 (GRCm39) probably null Het
Steap1 A T 5: 5,789,940 (GRCm39) D24E probably damaging Het
Svep1 T C 4: 58,054,604 (GRCm39) E3328G possibly damaging Het
Tdpoz3 T C 3: 93,734,399 (GRCm39) V358A probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmem184a C A 5: 139,791,311 (GRCm39) A426S probably benign Het
Tnc T C 4: 63,927,087 (GRCm39) D813G probably damaging Het
Top1 A G 2: 160,547,182 (GRCm39) T419A possibly damaging Het
Ttll4 T C 1: 74,720,975 (GRCm39) I547T probably damaging Het
Vmn1r193 T C 13: 22,403,920 (GRCm39) D24G possibly damaging Het
Wfs1 C T 5: 37,124,287 (GRCm39) R792H probably damaging Het
Zfp607a A G 7: 27,577,944 (GRCm39) D338G possibly damaging Het
Zfp949 C T 9: 88,450,771 (GRCm39) R114C possibly damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118,033,513 (GRCm39) missense probably damaging 0.98
IGL01135:Syt17 APN 7 117,981,270 (GRCm39) missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118,007,389 (GRCm39) missense probably damaging 0.99
IGL01610:Syt17 APN 7 118,033,216 (GRCm39) missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118,009,176 (GRCm39) missense probably damaging 0.99
IGL02125:Syt17 APN 7 118,009,197 (GRCm39) missense probably benign 0.01
IGL02819:Syt17 APN 7 118,009,143 (GRCm39) splice site probably benign
H8562:Syt17 UTSW 7 118,007,292 (GRCm39) missense probably benign 0.01
R0127:Syt17 UTSW 7 118,009,164 (GRCm39) missense probably damaging 0.98
R0328:Syt17 UTSW 7 117,981,216 (GRCm39) missense probably benign 0.28
R1789:Syt17 UTSW 7 118,036,061 (GRCm39) missense probably benign 0.00
R1872:Syt17 UTSW 7 118,007,341 (GRCm39) missense probably benign 0.00
R1878:Syt17 UTSW 7 118,033,468 (GRCm39) missense probably benign 0.01
R1918:Syt17 UTSW 7 118,033,208 (GRCm39) missense possibly damaging 0.54
R2133:Syt17 UTSW 7 117,981,270 (GRCm39) missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118,033,180 (GRCm39) missense probably damaging 1.00
R4471:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4472:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4567:Syt17 UTSW 7 118,033,495 (GRCm39) missense probably benign 0.06
R5211:Syt17 UTSW 7 118,041,626 (GRCm39) missense probably benign 0.19
R5905:Syt17 UTSW 7 118,036,141 (GRCm39) missense probably benign 0.10
R6054:Syt17 UTSW 7 118,007,356 (GRCm39) missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118,033,513 (GRCm39) missense probably damaging 0.98
R6332:Syt17 UTSW 7 118,033,466 (GRCm39) missense probably benign 0.00
R7022:Syt17 UTSW 7 118,007,242 (GRCm39) missense probably benign 0.00
R7440:Syt17 UTSW 7 117,981,107 (GRCm39) missense probably damaging 1.00
R7610:Syt17 UTSW 7 118,033,682 (GRCm39) splice site probably null
R7845:Syt17 UTSW 7 118,009,194 (GRCm39) missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118,009,228 (GRCm39) missense probably damaging 0.99
R8296:Syt17 UTSW 7 118,036,069 (GRCm39) missense probably damaging 0.97
R8429:Syt17 UTSW 7 118,033,564 (GRCm39) missense probably benign
R9278:Syt17 UTSW 7 118,033,480 (GRCm39) missense probably damaging 1.00
R9622:Syt17 UTSW 7 118,036,191 (GRCm39) missense probably benign
R9629:Syt17 UTSW 7 118,007,379 (GRCm39) missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118,033,446 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AAAGAGAGGCCCATTGGACC -3'
(R):5'- GACCCAGAAGCCTGTGTTTGAG -3'

Sequencing Primer
(F):5'- GGACCTGCAAACTTTATATGCC -3'
(R):5'- TGTTTGAGGAACGCTACACC -3'
Posted On 2021-08-31