Incidental Mutation 'R8950:Kdm5b'
ID 681547
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R8950 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134541664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 746 (N746K)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047714
AA Change: N746K

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: N746K

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112198
AA Change: N746K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: N746K

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,823,595 (GRCm39) F374S possibly damaging Het
Abca14 T A 7: 119,823,644 (GRCm39) Y390* probably null Het
Abca9 T C 11: 110,054,206 (GRCm39) probably null Het
Anxa1 G T 19: 20,352,662 (GRCm39) S304* probably null Het
Aspm G A 1: 139,406,690 (GRCm39) R1859Q probably damaging Het
Atp13a5 A T 16: 29,197,314 (GRCm39) N14K probably damaging Het
Bmpr1a G T 14: 34,163,148 (GRCm39) H81N possibly damaging Het
Camkv C T 9: 107,824,296 (GRCm39) T236I probably damaging Het
Carm1 T A 9: 21,490,789 (GRCm39) M219K probably damaging Het
Ccdc162 T C 10: 41,474,507 (GRCm39) R1352G probably benign Het
Cd200l1 A T 16: 45,263,007 (GRCm39) V44D possibly damaging Het
Cib1 A G 7: 79,878,211 (GRCm39) L89P probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Crebbp A G 16: 4,031,023 (GRCm39) F22S probably damaging Het
Csf2rb A T 15: 78,232,520 (GRCm39) D609V probably benign Het
Csn1s1 T C 5: 87,824,482 (GRCm39) probably null Het
Dchs1 A T 7: 105,408,212 (GRCm39) H1873Q probably benign Het
Dnah1 T C 14: 31,012,396 (GRCm39) D1901G probably damaging Het
Dock10 G T 1: 80,519,016 (GRCm39) T1235N probably benign Het
Eddm3b T A 14: 51,354,110 (GRCm39) S33T probably damaging Het
Fam151b A T 13: 92,610,567 (GRCm39) M74K probably damaging Het
Fat1 T A 8: 45,476,158 (GRCm39) F1735I probably damaging Het
Fcgbpl1 A G 7: 27,863,751 (GRCm39) R2508G probably benign Het
Fip1l1 T G 5: 74,756,524 (GRCm39) S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gpr180 A G 14: 118,395,452 (GRCm39) I295V probably benign Het
Gtf3c2 G A 5: 31,331,151 (GRCm39) T175I probably damaging Het
Hmcn2 T C 2: 31,244,741 (GRCm39) Y733H probably damaging Het
Irs1 T A 1: 82,264,652 (GRCm39) Q1188L probably benign Het
Kcnk5 T C 14: 20,192,046 (GRCm39) R372G probably benign Het
Kdm7a T C 6: 39,123,903 (GRCm39) I754V probably benign Het
Mad2l1bp G A 17: 46,458,891 (GRCm39) T213I possibly damaging Het
Map2 G T 1: 66,419,684 (GRCm39) R5L probably damaging Het
Map4 G A 9: 109,901,702 (GRCm39) V781M possibly damaging Het
Mbd2 A G 18: 70,713,864 (GRCm39) D231G probably damaging Het
Negr1 C A 3: 156,721,906 (GRCm39) P160Q probably damaging Het
Nfya A T 17: 48,700,489 (GRCm39) probably benign Het
Nlk T C 11: 78,586,758 (GRCm39) Q112R probably benign Het
Obscn C A 11: 58,947,009 (GRCm39) A4339S probably damaging Het
Or3a10 A G 11: 73,935,782 (GRCm39) F106S possibly damaging Het
Or5b99 A T 19: 12,976,445 (GRCm39) I32F probably damaging Het
Pcdhb12 A G 18: 37,570,590 (GRCm39) T579A probably benign Het
Pcdhb2 G A 18: 37,429,715 (GRCm39) V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Piezo1 T C 8: 123,208,729 (GRCm39) R2545G probably benign Het
Plcb1 A G 2: 135,179,439 (GRCm39) N616D probably damaging Het
Pogk A T 1: 166,226,394 (GRCm39) F586I probably damaging Het
Polr1f T A 12: 33,483,526 (GRCm39) Y93N probably damaging Het
Prkg2 T A 5: 99,119,815 (GRCm39) I435F possibly damaging Het
Prrt4 T C 6: 29,177,665 (GRCm39) T35A probably damaging Het
Rad17 A G 13: 100,767,576 (GRCm39) S342P probably damaging Het
Rpl36-ps4 A G 17: 88,228,574 (GRCm39) T40A probably damaging Het
Skint5 T C 4: 113,374,349 (GRCm39) T1247A unknown Het
Slc22a14 A G 9: 118,998,778 (GRCm39) L182P possibly damaging Het
Slc35b3 T C 13: 39,138,097 (GRCm39) D104G probably damaging Het
Sult2a1 A G 7: 13,530,342 (GRCm39) F266L probably damaging Het
Sult2a2 A T 7: 13,467,484 (GRCm39) M1L probably damaging Het
Tat T A 8: 110,718,337 (GRCm39) I74N probably damaging Het
Trappc6a G T 7: 19,249,923 (GRCm39) probably benign Het
Usp44 A G 10: 93,682,129 (GRCm39) E193G possibly damaging Het
Virma C T 4: 11,519,047 (GRCm39) Q765* probably null Het
Vmn1r46 T C 6: 89,954,053 (GRCm39) S301P probably damaging Het
Vmn2r116 A T 17: 23,620,467 (GRCm39) I734F probably damaging Het
Vmn2r5 A T 3: 64,398,522 (GRCm39) V819D probably damaging Het
Vmn2r74 A G 7: 85,606,569 (GRCm39) I259T probably damaging Het
Vps13a A G 19: 16,723,340 (GRCm39) I286T probably damaging Het
Wdr73 T C 7: 80,550,131 (GRCm39) I55V probably benign Het
Znhit2 A T 19: 6,111,803 (GRCm39) R183* probably null Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTTGAGTGCACATGTATGC -3'
(R):5'- AAGCAGGAAATTAGGCTGTTTC -3'

Sequencing Primer
(F):5'- ACCACCACACATAGGTTTTGGGG -3'
(R):5'- CTGTTTCAAAACGTTGGCTGCAAC -3'
Posted On 2021-08-31