Incidental Mutation 'R8950:Kdm5b'
ID 681547
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine (K)-specific demethylase 5B
Synonyms Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock # R8950 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 134560171-134635285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134613926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 746 (N746K)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047714
AA Change: N746K

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: N746K

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112198
AA Change: N746K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: N746K

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,164,326 R2508G probably benign Het
Abca14 T A 7: 120,224,421 Y390* probably null Het
Abca14 T C 7: 120,224,372 F374S possibly damaging Het
Abca9 T C 11: 110,163,380 probably null Het
Anxa1 G T 19: 20,375,298 S304* probably null Het
Aspm G A 1: 139,478,952 R1859Q probably damaging Het
Atp13a5 A T 16: 29,378,496 N14K probably damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Carm1 T A 9: 21,579,493 M219K probably damaging Het
Ccdc162 T C 10: 41,598,511 R1352G probably benign Het
Cib1 A G 7: 80,228,463 L89P probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Crebbp A G 16: 4,213,159 F22S probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Csn1s1 T C 5: 87,676,623 probably null Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Dock10 G T 1: 80,541,299 T1235N probably benign Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Fam151b A T 13: 92,474,059 M74K probably damaging Het
Fat1 T A 8: 45,023,121 F1735I probably damaging Het
Fip1l1 T G 5: 74,595,863 S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm609 A T 16: 45,442,644 V44D possibly damaging Het
Gpr180 A G 14: 118,158,040 I295V probably benign Het
Gtf3c2 G A 5: 31,173,807 T175I probably damaging Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Irs1 T A 1: 82,286,931 Q1188L probably benign Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kdm7a T C 6: 39,146,969 I754V probably benign Het
Mad2l1bp G A 17: 46,147,965 T213I possibly damaging Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Mbd2 A G 18: 70,580,793 D231G probably damaging Het
Negr1 C A 3: 157,016,269 P160Q probably damaging Het
Nfya A T 17: 48,393,461 probably benign Het
Nlk T C 11: 78,695,932 Q112R probably benign Het
Obscn C A 11: 59,056,183 A4339S probably damaging Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Pcdhb12 A G 18: 37,437,537 T579A probably benign Het
Pcdhb2 G A 18: 37,296,662 V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo1 T C 8: 122,481,990 R2545G probably benign Het
Plcb1 A G 2: 135,337,519 N616D probably damaging Het
Pogk A T 1: 166,398,825 F586I probably damaging Het
Prkg2 T A 5: 98,971,956 I435F possibly damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Rad17 A G 13: 100,631,068 S342P probably damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Skint5 T C 4: 113,517,152 T1247A unknown Het
Slc22a14 A G 9: 119,169,710 L182P possibly damaging Het
Slc35b3 T C 13: 38,954,121 D104G probably damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Tat T A 8: 109,991,705 I74N probably damaging Het
Trappc6a G T 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Usp44 A G 10: 93,846,267 E193G possibly damaging Het
Virma C T 4: 11,519,047 Q765* probably null Het
Vmn1r46 T C 6: 89,977,071 S301P probably damaging Het
Vmn2r116 A T 17: 23,401,493 I734F probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Wdr73 T C 7: 80,900,383 I55V probably benign Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R9089:Kdm5b UTSW 1 134607768 missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9133:Kdm5b UTSW 1 134602585 missense probably benign
R9298:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9423:Kdm5b UTSW 1 134587967 missense possibly damaging 0.85
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTTGAGTGCACATGTATGC -3'
(R):5'- AAGCAGGAAATTAGGCTGTTTC -3'

Sequencing Primer
(F):5'- ACCACCACACATAGGTTTTGGGG -3'
(R):5'- CTGTTTCAAAACGTTGGCTGCAAC -3'
Posted On 2021-08-31