Incidental Mutation 'R0734:Nf2'
ID68155
Institutional Source Beutler Lab
Gene Symbol Nf2
Ensembl Gene ENSMUSG00000009073
Gene Nameneurofibromin 2
Synonymsmoesin-ezrin-radixin-like protein, merlin, schwannomin
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0734 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4765845-4849536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4820409 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 67 (T67A)
Ref Sequence ENSEMBL: ENSMUSP00000129388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053079] [ENSMUST00000056290] [ENSMUST00000109910] [ENSMUST00000152656] [ENSMUST00000164190]
Predicted Effect probably benign
Transcript: ENSMUST00000053079
AA Change: T67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055033
Gene: ENSMUSG00000009073
AA Change: T67A

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056290
AA Change: T67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055061
Gene: ENSMUSG00000009073
AA Change: T67A

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093374
SMART Domains Protein: ENSMUSP00000091066
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 2 152 2.21e-33 SMART
FERM_C 156 245 1.08e-30 SMART
Pfam:ERM 277 515 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109908
Predicted Effect probably benign
Transcript: ENSMUST00000109910
AA Change: T67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105536
Gene: ENSMUSG00000009073
AA Change: T67A

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 596 5.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124878
SMART Domains Protein: ENSMUSP00000132184
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
Pfam:FERM_M 35 83 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137926
SMART Domains Protein: ENSMUSP00000116505
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 2 116 1.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152656
SMART Domains Protein: ENSMUSP00000128494
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
Blast:B41 1 28 2e-9 BLAST
PDB:1E5W|A 1 28 7e-6 PDB
FERM_C 29 118 1.08e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164190
AA Change: T67A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129388
Gene: ENSMUSG00000009073
AA Change: T67A

DomainStartEndE-ValueType
B41 18 181 1.24e-45 SMART
FERM_C 160 229 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167480
Meta Mutation Damage Score 0.3434 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants lack extraembryonic ectoderm, do not initiate gastrulation and die by embryonic day 7. Heterozygotes develop malignant tumors, especially osteosarcomas. Conditional Schwann cell knockouts resemble neurofibromatosis type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Nf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Nf2 APN 11 4791123 missense probably benign 0.00
IGL01072:Nf2 APN 11 4789713 missense probably null 0.00
IGL01349:Nf2 APN 11 4784472 missense possibly damaging 0.94
IGL01686:Nf2 APN 11 4818613 missense probably benign
IGL01820:Nf2 APN 11 4789655 unclassified probably null
IGL02251:Nf2 APN 11 4848873 missense probably null 1.00
IGL02755:Nf2 APN 11 4818542 missense probably damaging 1.00
IGL02859:Nf2 APN 11 4791209 missense probably damaging 1.00
R0331:Nf2 UTSW 11 4794914 missense probably benign 0.21
R0513:Nf2 UTSW 11 4791185 missense possibly damaging 0.56
R0606:Nf2 UTSW 11 4782194 missense possibly damaging 0.90
R1749:Nf2 UTSW 11 4803694 missense possibly damaging 0.60
R2192:Nf2 UTSW 11 4799899 missense probably damaging 1.00
R4073:Nf2 UTSW 11 4848958 missense probably benign 0.27
R4355:Nf2 UTSW 11 4780613 nonsense probably null
R4629:Nf2 UTSW 11 4848915 missense probably damaging 0.99
R5129:Nf2 UTSW 11 4816145 missense probably benign
R5130:Nf2 UTSW 11 4829862 intron probably benign
R5580:Nf2 UTSW 11 4803689 missense probably damaging 1.00
R5599:Nf2 UTSW 11 4782269 missense probably damaging 1.00
R5840:Nf2 UTSW 11 4816146 missense probably benign 0.24
R6017:Nf2 UTSW 11 4816137 missense possibly damaging 0.95
R6029:Nf2 UTSW 11 4784566 splice site probably null
R6230:Nf2 UTSW 11 4808262 missense possibly damaging 0.81
R6897:Nf2 UTSW 11 4799878 missense probably damaging 1.00
R6990:Nf2 UTSW 11 4799944 missense probably benign 0.09
R7155:Nf2 UTSW 11 4799964 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCCTGTGACACCTCAACAATG -3'
(R):5'- TGTGCTCCGCAGCAATTAAGCC -3'

Sequencing Primer
(F):5'- TGACACCTCAACAATGAGCAAATAAG -3'
(R):5'- CATCAGCCATTTTGGTGACAG -3'
Posted On2013-09-03