Incidental Mutation 'R8950:Plcb1'
ID681551
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8950 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135337519 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 616 (N616D)
Ref Sequence ENSEMBL: ENSMUSP00000105743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably damaging
Transcript: ENSMUST00000070724
AA Change: N616D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: N616D

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110116
AA Change: N616D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: N616D

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131552
AA Change: N616D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: N616D

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,164,326 R2508G probably benign Het
Abca14 T C 7: 120,224,372 F374S possibly damaging Het
Abca14 T A 7: 120,224,421 Y390* probably null Het
Abca9 T C 11: 110,163,380 probably null Het
Anxa1 G T 19: 20,375,298 S304* probably null Het
Aspm G A 1: 139,478,952 R1859Q probably damaging Het
Atp13a5 A T 16: 29,378,496 N14K probably damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Carm1 T A 9: 21,579,493 M219K probably damaging Het
Ccdc162 T C 10: 41,598,511 R1352G probably benign Het
Cib1 A G 7: 80,228,463 L89P probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Crebbp A G 16: 4,213,159 F22S probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Csn1s1 T C 5: 87,676,623 probably null Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Dock10 G T 1: 80,541,299 T1235N probably benign Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Fam151b A T 13: 92,474,059 M74K probably damaging Het
Fat1 T A 8: 45,023,121 F1735I probably damaging Het
Fip1l1 T G 5: 74,595,863 S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm609 A T 16: 45,442,644 V44D possibly damaging Het
Gpr180 A G 14: 118,158,040 I295V probably benign Het
Gtf3c2 G A 5: 31,173,807 T175I probably damaging Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Irs1 T A 1: 82,286,931 Q1188L probably benign Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kdm5b T A 1: 134,613,926 N746K possibly damaging Het
Kdm7a T C 6: 39,146,969 I754V probably benign Het
Mad2l1bp G A 17: 46,147,965 T213I possibly damaging Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Mbd2 A G 18: 70,580,793 D231G probably damaging Het
Negr1 C A 3: 157,016,269 P160Q probably damaging Het
Nfya A T 17: 48,393,461 probably benign Het
Nlk T C 11: 78,695,932 Q112R probably benign Het
Obscn C A 11: 59,056,183 A4339S probably damaging Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Pcdhb12 A G 18: 37,437,537 T579A probably benign Het
Pcdhb2 G A 18: 37,296,662 V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo1 T C 8: 122,481,990 R2545G probably benign Het
Pogk A T 1: 166,398,825 F586I probably damaging Het
Prkg2 T A 5: 98,971,956 I435F possibly damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Rad17 A G 13: 100,631,068 S342P probably damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Skint5 T C 4: 113,517,152 T1247A unknown Het
Slc22a14 A G 9: 119,169,710 L182P possibly damaging Het
Slc35b3 T C 13: 38,954,121 D104G probably damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Tat T A 8: 109,991,705 I74N probably damaging Het
Trappc6a G T 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Usp44 A G 10: 93,846,267 E193G possibly damaging Het
Virma C T 4: 11,519,047 Q765* probably null Het
Vmn1r46 T C 6: 89,977,071 S301P probably damaging Het
Vmn2r116 A T 17: 23,401,493 I734F probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Wdr73 T C 7: 80,900,383 I55V probably benign Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8693:Plcb1 UTSW 2 135252776 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCATATCTCACCCATCGATTCG -3'
(R):5'- TGTCAGTACACATATGACTGTAGG -3'

Sequencing Primer
(F):5'- AATATCTATTTTGTTTCCCCAGTGAG -3'
(R):5'- ACTGTAGGAAAATAGCATGAAATCC -3'
Posted On2021-08-31