Incidental Mutation 'R8950:Usp44'
ID 681583
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8950 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93831555-93858088 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93846267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 193 (E193G)
Ref Sequence ENSEMBL: ENSMUSP00000092975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect possibly damaging
Transcript: ENSMUST00000095333
AA Change: E193G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: E193G

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216224
AA Change: E193G

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,164,326 R2508G probably benign Het
Abca14 T C 7: 120,224,372 F374S possibly damaging Het
Abca14 T A 7: 120,224,421 Y390* probably null Het
Abca9 T C 11: 110,163,380 probably null Het
Anxa1 G T 19: 20,375,298 S304* probably null Het
Aspm G A 1: 139,478,952 R1859Q probably damaging Het
Atp13a5 A T 16: 29,378,496 N14K probably damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Carm1 T A 9: 21,579,493 M219K probably damaging Het
Ccdc162 T C 10: 41,598,511 R1352G probably benign Het
Cib1 A G 7: 80,228,463 L89P probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Crebbp A G 16: 4,213,159 F22S probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Csn1s1 T C 5: 87,676,623 probably null Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Dock10 G T 1: 80,541,299 T1235N probably benign Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Fam151b A T 13: 92,474,059 M74K probably damaging Het
Fat1 T A 8: 45,023,121 F1735I probably damaging Het
Fip1l1 T G 5: 74,595,863 S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm609 A T 16: 45,442,644 V44D possibly damaging Het
Gpr180 A G 14: 118,158,040 I295V probably benign Het
Gtf3c2 G A 5: 31,173,807 T175I probably damaging Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Irs1 T A 1: 82,286,931 Q1188L probably benign Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kdm5b T A 1: 134,613,926 N746K possibly damaging Het
Kdm7a T C 6: 39,146,969 I754V probably benign Het
Mad2l1bp G A 17: 46,147,965 T213I possibly damaging Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Mbd2 A G 18: 70,580,793 D231G probably damaging Het
Negr1 C A 3: 157,016,269 P160Q probably damaging Het
Nfya A T 17: 48,393,461 probably benign Het
Nlk T C 11: 78,695,932 Q112R probably benign Het
Obscn C A 11: 59,056,183 A4339S probably damaging Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Pcdhb12 A G 18: 37,437,537 T579A probably benign Het
Pcdhb2 G A 18: 37,296,662 V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo1 T C 8: 122,481,990 R2545G probably benign Het
Plcb1 A G 2: 135,337,519 N616D probably damaging Het
Pogk A T 1: 166,398,825 F586I probably damaging Het
Prkg2 T A 5: 98,971,956 I435F possibly damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Rad17 A G 13: 100,631,068 S342P probably damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Skint5 T C 4: 113,517,152 T1247A unknown Het
Slc22a14 A G 9: 119,169,710 L182P possibly damaging Het
Slc35b3 T C 13: 38,954,121 D104G probably damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Tat T A 8: 109,991,705 I74N probably damaging Het
Trappc6a G T 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Virma C T 4: 11,519,047 Q765* probably null Het
Vmn1r46 T C 6: 89,977,071 S301P probably damaging Het
Vmn2r116 A T 17: 23,401,493 I734F probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Wdr73 T C 7: 80,900,383 I55V probably benign Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93845655 start gained probably benign
R0497:Usp44 UTSW 10 93846806 missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93847220 intron probably benign
R1521:Usp44 UTSW 10 93847186 nonsense probably null
R4032:Usp44 UTSW 10 93847265 intron probably benign
R4212:Usp44 UTSW 10 93846770 missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93846906 missense probably damaging 1.00
R4764:Usp44 UTSW 10 93846071 missense probably benign 0.17
R5095:Usp44 UTSW 10 93846845 missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93845978 missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93846632 missense probably damaging 0.96
R6193:Usp44 UTSW 10 93847148 intron probably benign
R6233:Usp44 UTSW 10 93850340 missense probably damaging 1.00
R6338:Usp44 UTSW 10 93846513 missense probably damaging 1.00
R6374:Usp44 UTSW 10 93856310 missense probably benign 0.12
R6556:Usp44 UTSW 10 93846008 missense probably benign 0.20
R6615:Usp44 UTSW 10 93846489 missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93850187 missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93845993 missense probably benign 0.08
R7361:Usp44 UTSW 10 93846468 missense probably benign 0.00
R7576:Usp44 UTSW 10 93846428 missense probably damaging 0.99
R8014:Usp44 UTSW 10 93852709 critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93846503 missense probably damaging 1.00
R8919:Usp44 UTSW 10 93857913 missense probably benign 0.00
R9144:Usp44 UTSW 10 93845783 missense probably benign 0.09
R9254:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93846989 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGACTCGGTTTTACATCCTGTG -3'
(R):5'- TCTTCCGAAGTAGGTAGCGC -3'

Sequencing Primer
(F):5'- ATGCACAGGACCGTGTTTAC -3'
(R):5'- AGGTAGCGCGGCTTTGTCC -3'
Posted On 2021-08-31