Incidental Mutation 'R8950:Usp44'
ID 681583
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms E430004F17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8950 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93667417-93693950 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93682129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 193 (E193G)
Ref Sequence ENSEMBL: ENSMUSP00000092975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect possibly damaging
Transcript: ENSMUST00000095333
AA Change: E193G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: E193G

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216224
AA Change: E193G

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,823,595 (GRCm39) F374S possibly damaging Het
Abca14 T A 7: 119,823,644 (GRCm39) Y390* probably null Het
Abca9 T C 11: 110,054,206 (GRCm39) probably null Het
Anxa1 G T 19: 20,352,662 (GRCm39) S304* probably null Het
Aspm G A 1: 139,406,690 (GRCm39) R1859Q probably damaging Het
Atp13a5 A T 16: 29,197,314 (GRCm39) N14K probably damaging Het
Bmpr1a G T 14: 34,163,148 (GRCm39) H81N possibly damaging Het
Camkv C T 9: 107,824,296 (GRCm39) T236I probably damaging Het
Carm1 T A 9: 21,490,789 (GRCm39) M219K probably damaging Het
Ccdc162 T C 10: 41,474,507 (GRCm39) R1352G probably benign Het
Cd200l1 A T 16: 45,263,007 (GRCm39) V44D possibly damaging Het
Cib1 A G 7: 79,878,211 (GRCm39) L89P probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Crebbp A G 16: 4,031,023 (GRCm39) F22S probably damaging Het
Csf2rb A T 15: 78,232,520 (GRCm39) D609V probably benign Het
Csn1s1 T C 5: 87,824,482 (GRCm39) probably null Het
Dchs1 A T 7: 105,408,212 (GRCm39) H1873Q probably benign Het
Dnah1 T C 14: 31,012,396 (GRCm39) D1901G probably damaging Het
Dock10 G T 1: 80,519,016 (GRCm39) T1235N probably benign Het
Eddm3b T A 14: 51,354,110 (GRCm39) S33T probably damaging Het
Fam151b A T 13: 92,610,567 (GRCm39) M74K probably damaging Het
Fat1 T A 8: 45,476,158 (GRCm39) F1735I probably damaging Het
Fcgbpl1 A G 7: 27,863,751 (GRCm39) R2508G probably benign Het
Fip1l1 T G 5: 74,756,524 (GRCm39) S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gpr180 A G 14: 118,395,452 (GRCm39) I295V probably benign Het
Gtf3c2 G A 5: 31,331,151 (GRCm39) T175I probably damaging Het
Hmcn2 T C 2: 31,244,741 (GRCm39) Y733H probably damaging Het
Irs1 T A 1: 82,264,652 (GRCm39) Q1188L probably benign Het
Kcnk5 T C 14: 20,192,046 (GRCm39) R372G probably benign Het
Kdm5b T A 1: 134,541,664 (GRCm39) N746K possibly damaging Het
Kdm7a T C 6: 39,123,903 (GRCm39) I754V probably benign Het
Mad2l1bp G A 17: 46,458,891 (GRCm39) T213I possibly damaging Het
Map2 G T 1: 66,419,684 (GRCm39) R5L probably damaging Het
Map4 G A 9: 109,901,702 (GRCm39) V781M possibly damaging Het
Mbd2 A G 18: 70,713,864 (GRCm39) D231G probably damaging Het
Negr1 C A 3: 156,721,906 (GRCm39) P160Q probably damaging Het
Nfya A T 17: 48,700,489 (GRCm39) probably benign Het
Nlk T C 11: 78,586,758 (GRCm39) Q112R probably benign Het
Obscn C A 11: 58,947,009 (GRCm39) A4339S probably damaging Het
Or3a10 A G 11: 73,935,782 (GRCm39) F106S possibly damaging Het
Or5b99 A T 19: 12,976,445 (GRCm39) I32F probably damaging Het
Pcdhb12 A G 18: 37,570,590 (GRCm39) T579A probably benign Het
Pcdhb2 G A 18: 37,429,715 (GRCm39) V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Piezo1 T C 8: 123,208,729 (GRCm39) R2545G probably benign Het
Plcb1 A G 2: 135,179,439 (GRCm39) N616D probably damaging Het
Pogk A T 1: 166,226,394 (GRCm39) F586I probably damaging Het
Polr1f T A 12: 33,483,526 (GRCm39) Y93N probably damaging Het
Prkg2 T A 5: 99,119,815 (GRCm39) I435F possibly damaging Het
Prrt4 T C 6: 29,177,665 (GRCm39) T35A probably damaging Het
Rad17 A G 13: 100,767,576 (GRCm39) S342P probably damaging Het
Rpl36-ps4 A G 17: 88,228,574 (GRCm39) T40A probably damaging Het
Skint5 T C 4: 113,374,349 (GRCm39) T1247A unknown Het
Slc22a14 A G 9: 118,998,778 (GRCm39) L182P possibly damaging Het
Slc35b3 T C 13: 39,138,097 (GRCm39) D104G probably damaging Het
Sult2a1 A G 7: 13,530,342 (GRCm39) F266L probably damaging Het
Sult2a2 A T 7: 13,467,484 (GRCm39) M1L probably damaging Het
Tat T A 8: 110,718,337 (GRCm39) I74N probably damaging Het
Trappc6a G T 7: 19,249,923 (GRCm39) probably benign Het
Virma C T 4: 11,519,047 (GRCm39) Q765* probably null Het
Vmn1r46 T C 6: 89,954,053 (GRCm39) S301P probably damaging Het
Vmn2r116 A T 17: 23,620,467 (GRCm39) I734F probably damaging Het
Vmn2r5 A T 3: 64,398,522 (GRCm39) V819D probably damaging Het
Vmn2r74 A G 7: 85,606,569 (GRCm39) I259T probably damaging Het
Vps13a A G 19: 16,723,340 (GRCm39) I286T probably damaging Het
Wdr73 T C 7: 80,550,131 (GRCm39) I55V probably benign Het
Znhit2 A T 19: 6,111,803 (GRCm39) R183* probably null Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93,681,517 (GRCm39) start gained probably benign
R0497:Usp44 UTSW 10 93,682,668 (GRCm39) missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93,683,082 (GRCm39) intron probably benign
R1521:Usp44 UTSW 10 93,683,048 (GRCm39) nonsense probably null
R4032:Usp44 UTSW 10 93,683,127 (GRCm39) intron probably benign
R4212:Usp44 UTSW 10 93,682,632 (GRCm39) missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93,682,768 (GRCm39) missense probably damaging 1.00
R4764:Usp44 UTSW 10 93,681,933 (GRCm39) missense probably benign 0.17
R5095:Usp44 UTSW 10 93,682,707 (GRCm39) missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93,681,840 (GRCm39) missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93,682,494 (GRCm39) missense probably damaging 0.96
R6193:Usp44 UTSW 10 93,683,010 (GRCm39) intron probably benign
R6233:Usp44 UTSW 10 93,686,202 (GRCm39) missense probably damaging 1.00
R6338:Usp44 UTSW 10 93,682,375 (GRCm39) missense probably damaging 1.00
R6374:Usp44 UTSW 10 93,692,172 (GRCm39) missense probably benign 0.12
R6556:Usp44 UTSW 10 93,681,870 (GRCm39) missense probably benign 0.20
R6615:Usp44 UTSW 10 93,682,351 (GRCm39) missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93,686,049 (GRCm39) missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93,681,855 (GRCm39) missense probably benign 0.08
R7361:Usp44 UTSW 10 93,682,330 (GRCm39) missense probably benign 0.00
R7576:Usp44 UTSW 10 93,682,290 (GRCm39) missense probably damaging 0.99
R8014:Usp44 UTSW 10 93,688,571 (GRCm39) critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93,682,365 (GRCm39) missense probably damaging 1.00
R8919:Usp44 UTSW 10 93,693,775 (GRCm39) missense probably benign 0.00
R9144:Usp44 UTSW 10 93,681,645 (GRCm39) missense probably benign 0.09
R9254:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93,682,851 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGACTCGGTTTTACATCCTGTG -3'
(R):5'- TCTTCCGAAGTAGGTAGCGC -3'

Sequencing Primer
(F):5'- ATGCACAGGACCGTGTTTAC -3'
(R):5'- AGGTAGCGCGGCTTTGTCC -3'
Posted On 2021-08-31