Incidental Mutation 'R8950:Slc35b3'
ID 681589
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Name solute carrier family 35, member B3
Synonyms 4921526O06Rik, PAPST2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock # R8950 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 38932136-38960875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38954121 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 104 (D104G)
Ref Sequence ENSEMBL: ENSMUSP00000153154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225331] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
AlphaFold Q922Q5
Predicted Effect probably benign
Transcript: ENSMUST00000021870
AA Change: D148G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: D148G

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167513
AA Change: D104G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: D104G

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
Predicted Effect probably benign
Transcript: ENSMUST00000225331
AA Change: D104G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000225432
AA Change: D104G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably damaging
Transcript: ENSMUST00000225461
AA Change: D104G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000225568
Predicted Effect probably damaging
Transcript: ENSMUST00000225714
AA Change: D104G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,164,326 R2508G probably benign Het
Abca14 T C 7: 120,224,372 F374S possibly damaging Het
Abca14 T A 7: 120,224,421 Y390* probably null Het
Abca9 T C 11: 110,163,380 probably null Het
Anxa1 G T 19: 20,375,298 S304* probably null Het
Aspm G A 1: 139,478,952 R1859Q probably damaging Het
Atp13a5 A T 16: 29,378,496 N14K probably damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Carm1 T A 9: 21,579,493 M219K probably damaging Het
Ccdc162 T C 10: 41,598,511 R1352G probably benign Het
Cib1 A G 7: 80,228,463 L89P probably damaging Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Crebbp A G 16: 4,213,159 F22S probably damaging Het
Csf2rb A T 15: 78,348,320 D609V probably benign Het
Csn1s1 T C 5: 87,676,623 probably null Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Dock10 G T 1: 80,541,299 T1235N probably benign Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Fam151b A T 13: 92,474,059 M74K probably damaging Het
Fat1 T A 8: 45,023,121 F1735I probably damaging Het
Fip1l1 T G 5: 74,595,863 S505R probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm609 A T 16: 45,442,644 V44D possibly damaging Het
Gpr180 A G 14: 118,158,040 I295V probably benign Het
Gtf3c2 G A 5: 31,173,807 T175I probably damaging Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Irs1 T A 1: 82,286,931 Q1188L probably benign Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kdm5b T A 1: 134,613,926 N746K possibly damaging Het
Kdm7a T C 6: 39,146,969 I754V probably benign Het
Mad2l1bp G A 17: 46,147,965 T213I possibly damaging Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Mbd2 A G 18: 70,580,793 D231G probably damaging Het
Negr1 C A 3: 157,016,269 P160Q probably damaging Het
Nfya A T 17: 48,393,461 probably benign Het
Nlk T C 11: 78,695,932 Q112R probably benign Het
Obscn C A 11: 59,056,183 A4339S probably damaging Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Pcdhb12 A G 18: 37,437,537 T579A probably benign Het
Pcdhb2 G A 18: 37,296,662 V563M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Piezo1 T C 8: 122,481,990 R2545G probably benign Het
Plcb1 A G 2: 135,337,519 N616D probably damaging Het
Pogk A T 1: 166,398,825 F586I probably damaging Het
Prkg2 T A 5: 98,971,956 I435F possibly damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Rad17 A G 13: 100,631,068 S342P probably damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Skint5 T C 4: 113,517,152 T1247A unknown Het
Slc22a14 A G 9: 119,169,710 L182P possibly damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Tat T A 8: 109,991,705 I74N probably damaging Het
Trappc6a G T 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Usp44 A G 10: 93,846,267 E193G possibly damaging Het
Virma C T 4: 11,519,047 Q765* probably null Het
Vmn1r46 T C 6: 89,977,071 S301P probably damaging Het
Vmn2r116 A T 17: 23,401,493 I734F probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Wdr73 T C 7: 80,900,383 I55V probably benign Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3874:Slc35b3 UTSW 13 38943068 missense possibly damaging 0.66
R3897:Slc35b3 UTSW 13 38934763 missense probably benign 0.09
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6155:Slc35b3 UTSW 13 38944596 missense probably damaging 1.00
R6663:Slc35b3 UTSW 13 38954136 missense probably damaging 0.99
R7701:Slc35b3 UTSW 13 38944635 missense probably benign 0.03
R8534:Slc35b3 UTSW 13 38944590 missense probably benign 0.17
R8796:Slc35b3 UTSW 13 38937746 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTATTGTGACACCGCAC -3'
(R):5'- CGAGCTTCTAACAATTGATTGGAAG -3'

Sequencing Primer
(F):5'- TCTATTGTGACACCGCACTTCAAAC -3'
(R):5'- ACAATTGATTGGAAGTCCTCTCGG -3'
Posted On 2021-08-31