Incidental Mutation 'R0734:Dlg4'
ID68160
Institutional Source Beutler Lab
Gene Symbol Dlg4
Ensembl Gene ENSMUSG00000020886
Gene Namediscs large MAGUK scaffold protein 4
SynonymsPSD95, Dlgh4, SAP90, PSD-95, SAP90A
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0734 (G1)
Quality Score203
Status Validated
Chromosome11
Chromosomal Location70016942-70047522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70042705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 550 (G550R)
Ref Sequence ENSEMBL: ENSMUSP00000156059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018700] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000132597] [ENSMUST00000231415] [ENSMUST00000231452] [ENSMUST00000231506] [ENSMUST00000231628]
Predicted Effect probably damaging
Transcript: ENSMUST00000018700
AA Change: G550R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018700
Gene: ENSMUSG00000020886
AA Change: G550R

DomainStartEndE-ValueType
MAGUK_N_PEST 10 64 1.36e-4 SMART
PDZ 73 152 3.38e-21 SMART
PDZ 168 247 1.12e-21 SMART
PDZ 321 394 4.13e-25 SMART
SH3 431 497 1.68e-9 SMART
GuKc 533 712 3.65e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108588
AA Change: G610R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886
AA Change: G610R

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108589
AA Change: G653R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886
AA Change: G653R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123687
AA Change: G653R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886
AA Change: G653R

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131497
Predicted Effect probably benign
Transcript: ENSMUST00000132597
SMART Domains Protein: ENSMUSP00000114165
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
Pfam:MAGUK_N_PEST 2 43 5.8e-13 PFAM
PDZ 52 131 3.38e-21 SMART
PDZ 147 226 1.12e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231415
AA Change: G607R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231452
AA Change: G550R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231506
AA Change: G650R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231628
AA Change: G550R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9640 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. It heteromultimerizes with another MAGUK protein, DLG2, and is recruited into NMDA receptor and potassium channel clusters. These two MAGUK proteins may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severely impaired spatial learning, alterations in long-term potentiation and depression, and lack of hyperalgesia responses in a neuropathic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Dlg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Dlg4 APN 11 70041347 missense probably damaging 1.00
IGL02260:Dlg4 APN 11 70042267 missense probably damaging 1.00
IGL03097:Dlg4 UTSW 11 70042202 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0628:Dlg4 UTSW 11 70031784 missense probably damaging 1.00
R1587:Dlg4 UTSW 11 70031746 missense possibly damaging 0.88
R1946:Dlg4 UTSW 11 70039575 missense probably damaging 1.00
R2190:Dlg4 UTSW 11 70042604 missense probably damaging 1.00
R2259:Dlg4 UTSW 11 70031370 missense probably damaging 1.00
R2289:Dlg4 UTSW 11 70026926 missense probably damaging 1.00
R2411:Dlg4 UTSW 11 70041929 critical splice donor site probably null
R3161:Dlg4 UTSW 11 70017225 missense probably damaging 0.99
R4059:Dlg4 UTSW 11 70027083 missense probably benign
R4782:Dlg4 UTSW 11 70026954 missense probably damaging 1.00
R4910:Dlg4 UTSW 11 70030925 missense probably damaging 1.00
R5077:Dlg4 UTSW 11 70027026 missense possibly damaging 0.71
R5557:Dlg4 UTSW 11 70042280 missense probably damaging 1.00
R5996:Dlg4 UTSW 11 70017231 missense probably benign 0.00
R6649:Dlg4 UTSW 11 70023953 unclassified probably benign
R6653:Dlg4 UTSW 11 70023953 unclassified probably benign
R7155:Dlg4 UTSW 11 70017216 start codon destroyed probably null 0.00
R7284:Dlg4 UTSW 11 70042082 nonsense probably null
R7683:Dlg4 UTSW 11 70039854 missense possibly damaging 0.95
Z1088:Dlg4 UTSW 11 70031130 missense probably damaging 1.00
Z1176:Dlg4 UTSW 11 70041920 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATGACACTGGAGTAAAGCAGGA -3'
(R):5'- AGTGCAGACCCAGCAGGGAA -3'

Sequencing Primer
(F):5'- GGCTGATAATAGGCTGGCATC -3'
(R):5'- cagggaaagagacagagagaaag -3'
Posted On2013-09-03