Mutagenetix > Incidental Mutation

Incidental Mutation 'R8950:Vmn2r116'

681601

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R8950 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23401493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 734 (I734F)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

AlphaFold

E9Q6I0

Predicted Effect

probably damaging
Transcript: ENSMUST00000164856
AA Change: I734F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: I734F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,164,326	R2508G	probably benign	Het
Abca14	T	C	7: 120,224,372	F374S	possibly damaging	Het
Abca14	T	A	7: 120,224,421	Y390*	probably null	Het
Abca9	T	C	11: 110,163,380		probably null	Het
Anxa1	G	T	19: 20,375,298	S304*	probably null	Het
Aspm	G	A	1: 139,478,952	R1859Q	probably damaging	Het
Atp13a5	A	T	16: 29,378,496	N14K	probably damaging	Het
Bmpr1a	G	T	14: 34,441,191	H81N	possibly damaging	Het
Camkv	C	T	9: 107,947,097	T236I	probably damaging	Het
Carm1	T	A	9: 21,579,493	M219K	probably damaging	Het
Ccdc162	T	C	10: 41,598,511	R1352G	probably benign	Het
Cib1	A	G	7: 80,228,463	L89P	probably damaging	Het
Col6a5	C	T	9: 105,945,634	E175K	unknown	Het
Crebbp	A	G	16: 4,213,159	F22S	probably damaging	Het
Csf2rb	A	T	15: 78,348,320	D609V	probably benign	Het
Csn1s1	T	C	5: 87,676,623		probably null	Het
Dchs1	A	T	7: 105,759,005	H1873Q	probably benign	Het
Dnah1	T	C	14: 31,290,439	D1901G	probably damaging	Het
Dock10	G	T	1: 80,541,299	T1235N	probably benign	Het
Eddm3b	T	A	14: 51,116,653	S33T	probably damaging	Het
Fam151b	A	T	13: 92,474,059	M74K	probably damaging	Het
Fat1	T	A	8: 45,023,121	F1735I	probably damaging	Het
Fip1l1	T	G	5: 74,595,863	S505R	probably damaging	Het
Gm21886	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	18: 80,089,825		probably benign	Het
Gm609	A	T	16: 45,442,644	V44D	possibly damaging	Het
Gpr180	A	G	14: 118,158,040	I295V	probably benign	Het
Gtf3c2	G	A	5: 31,173,807	T175I	probably damaging	Het
Hmcn2	T	C	2: 31,354,729	Y733H	probably damaging	Het
Irs1	T	A	1: 82,286,931	Q1188L	probably benign	Het
Kcnk5	T	C	14: 20,141,978	R372G	probably benign	Het
Kdm5b	T	A	1: 134,613,926	N746K	possibly damaging	Het
Kdm7a	T	C	6: 39,146,969	I754V	probably benign	Het
Mad2l1bp	G	A	17: 46,147,965	T213I	possibly damaging	Het
Map2	G	T	1: 66,380,525	R5L	probably damaging	Het
Map4	G	A	9: 110,072,634	V781M	possibly damaging	Het
Mbd2	A	G	18: 70,580,793	D231G	probably damaging	Het
Negr1	C	A	3: 157,016,269	P160Q	probably damaging	Het
Nfya	A	T	17: 48,393,461		probably benign	Het
Nlk	T	C	11: 78,695,932	Q112R	probably benign	Het
Obscn	C	A	11: 59,056,183	A4339S	probably damaging	Het
Olfr139	A	G	11: 74,044,956	F106S	possibly damaging	Het
Olfr1451	A	T	19: 12,999,081	I32F	probably damaging	Het
Pcdhb12	A	G	18: 37,437,537	T579A	probably benign	Het
Pcdhb2	G	A	18: 37,296,662	V563M	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Piezo1	T	C	8: 122,481,990	R2545G	probably benign	Het
Plcb1	A	G	2: 135,337,519	N616D	probably damaging	Het
Pogk	A	T	1: 166,398,825	F586I	probably damaging	Het
Prkg2	T	A	5: 98,971,956	I435F	possibly damaging	Het
Prrt4	T	C	6: 29,177,666	T35A	probably damaging	Het
Rad17	A	G	13: 100,631,068	S342P	probably damaging	Het
Rpl36-ps4	A	G	17: 87,921,146	T40A	probably damaging	Het
Skint5	T	C	4: 113,517,152	T1247A	unknown	Het
Slc22a14	A	G	9: 119,169,710	L182P	possibly damaging	Het
Slc35b3	T	C	13: 38,954,121	D104G	probably damaging	Het
Sult2a1	A	G	7: 13,796,417	F266L	probably damaging	Het
Sult2a2	A	T	7: 13,733,559	M1L	probably damaging	Het
Tat	T	A	8: 109,991,705	I74N	probably damaging	Het
Trappc6a	G	T	7: 19,515,998		probably benign	Het
Twistnb	T	A	12: 33,433,527	Y93N	probably damaging	Het
Usp44	A	G	10: 93,846,267	E193G	possibly damaging	Het
Virma	C	T	4: 11,519,047	Q765*	probably null	Het
Vmn1r46	T	C	6: 89,977,071	S301P	probably damaging	Het
Vmn2r5	A	T	3: 64,491,101	V819D	probably damaging	Het
Vmn2r74	A	G	7: 85,957,361	I259T	probably damaging	Het
Vps13a	A	G	19: 16,745,976	I286T	probably damaging	Het
Wdr73	T	C	7: 80,900,383	I55V	probably benign	Het
Znhit2	A	T	19: 6,061,773	R183*	probably null	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0015:Vmn2r116	UTSW	17	23401849	missense	probably benign	0.03
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R0843:Vmn2r116	UTSW	17	23400960	missense	probably benign	0.01
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4298:Vmn2r116	UTSW	17	23401827	missense	possibly damaging	0.69
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5807:Vmn2r116	UTSW	17	23387307	missense	probably damaging	1.00
R5837:Vmn2r116	UTSW	17	23387080	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
R8956:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R8977:Vmn2r116	UTSW	17	23386942	missense	possibly damaging	0.56
R9030:Vmn2r116	UTSW	17	23384890	missense	possibly damaging	0.82
R9077:Vmn2r116	UTSW	17	23385982	missense	probably benign	0.14
R9223:Vmn2r116	UTSW	17	23401167	missense	probably damaging	1.00
R9401:Vmn2r116	UTSW	17	23401592	missense	probably damaging	1.00
R9449:Vmn2r116	UTSW	17	23386945	missense	probably benign	0.01
R9746:Vmn2r116	UTSW	17	23401823	missense	probably benign	0.08
R9755:Vmn2r116	UTSW	17	23401091	missense	probably damaging	1.00
R9759:Vmn2r116	UTSW	17	23401386	missense	possibly damaging	0.90
R9800:Vmn2r116	UTSW	17	23401425	missense	probably damaging	0.97
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCATTCAAAATCATAGCCTCC -3'
(R):5'- CTGCACTGGAAGCCAAAGTG -3'

Sequencing Primer
(F):5'- TCATAGCCTCCCAAAGAATGATG -3'
(R):5'- CCTTTGGTGCTATGGTAAACAG -3'

Posted On

2021-08-31