Incidental Mutation 'R8951:Oas1h'
ID 681632
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 068788-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8951 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 121000657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 89 (F89C)
Ref Sequence ENSEMBL: ENSMUSP00000132033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057814] [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably benign
Transcript: ENSMUST00000057814
SMART Domains Protein: ENSMUSP00000056993
Gene: ENSMUSG00000053765

DomainStartEndE-ValueType
Pfam:OAS1_C 169 353 4.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: F89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: F89C

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123431
Predicted Effect probably damaging
Transcript: ENSMUST00000171820
AA Change: F89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168
AA Change: F89C

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 T C 11: 102,665,193 (GRCm39) probably null Het
Adcy6 A T 15: 98,502,140 (GRCm39) V158E possibly damaging Het
Adgrg3 T C 8: 95,761,362 (GRCm39) probably benign Het
Arsb T C 13: 93,944,124 (GRCm39) S272P probably damaging Het
Asb10 A C 5: 24,742,952 (GRCm39) C260W probably damaging Het
Atp13a1 A G 8: 70,246,484 (GRCm39) D158G probably benign Het
Bcl6 T C 16: 23,793,704 (GRCm39) E81G probably damaging Het
C7 A T 15: 5,032,231 (GRCm39) V660E probably benign Het
Cacna1c T C 6: 118,590,300 (GRCm39) D1401G probably damaging Het
Ccp110 A G 7: 118,321,015 (GRCm39) I223M possibly damaging Het
Cilp A G 9: 65,180,220 (GRCm39) E187G probably benign Het
Cmc2 T C 8: 117,637,904 (GRCm39) N15S probably damaging Het
Cnnm3 T A 1: 36,558,019 (GRCm39) probably benign Het
Col27a1 T G 4: 63,191,311 (GRCm39) M828R possibly damaging Het
Cpm C T 10: 117,511,938 (GRCm39) P294L probably damaging Het
Cpt1a G C 19: 3,412,211 (GRCm39) A228P probably benign Het
Ctbp1 A G 5: 33,416,679 (GRCm39) V43A probably damaging Het
Cylc2 A T 4: 51,229,469 (GRCm39) E270D unknown Het
Cyp46a1 A C 12: 108,312,348 (GRCm39) R119S possibly damaging Het
Dctn3 A T 4: 41,719,845 (GRCm39) I87N probably damaging Het
Dhdds C T 4: 133,719,857 (GRCm39) V25I possibly damaging Het
Entpd1 A C 19: 40,727,319 (GRCm39) N489T probably damaging Het
Fam110a T C 2: 151,812,461 (GRCm39) D103G probably damaging Het
Foxo6 T A 4: 120,125,133 (GRCm39) Q554L unknown Het
Gbp5 T A 3: 142,206,481 (GRCm39) M55K probably damaging Het
Gm20730 T C 6: 43,058,638 (GRCm39) Y58C possibly damaging Het
Grip1 T A 10: 119,874,509 (GRCm39) S679T possibly damaging Het
Gtdc1 A C 2: 44,679,030 (GRCm39) probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Igha T A 12: 113,222,684 (GRCm39) N246Y Het
Ighg2b T A 12: 113,270,926 (GRCm39) T104S probably benign Het
Ighmbp2 C T 19: 3,318,726 (GRCm39) W450* probably null Het
Ipo11 T C 13: 106,978,690 (GRCm39) E839G possibly damaging Het
Iqce T C 5: 140,675,578 (GRCm39) D207G probably damaging Het
Irgm2 T C 11: 58,110,408 (GRCm39) V45A possibly damaging Het
Itga1 C T 13: 115,107,027 (GRCm39) W1021* probably null Het
Itga3 T C 11: 94,944,911 (GRCm39) Y799C probably damaging Het
Klf1 T C 8: 85,629,912 (GRCm39) S246P possibly damaging Het
Kras A T 6: 145,166,338 (GRCm39) M188K probably benign Het
Lacc1 C T 14: 77,272,613 (GRCm39) C61Y probably benign Het
Lect2 T A 13: 56,690,822 (GRCm39) probably benign Het
Leng9 G A 7: 4,152,782 (GRCm39) probably benign Het
Lhx9 A G 1: 138,769,704 (GRCm39) C6R probably damaging Het
Matn3 T A 12: 9,002,172 (GRCm39) I128K probably damaging Het
Ndst1 T C 18: 60,830,196 (GRCm39) E638G probably benign Het
Nell2 A T 15: 95,139,424 (GRCm39) C603S probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Or4d10c A T 19: 12,066,056 (GRCm39) Y33* probably null Het
Or52l1 A G 7: 104,829,638 (GRCm39) V294A probably damaging Het
Or5b101 T A 19: 13,004,827 (GRCm39) S289C Het
Or5d45 C T 2: 88,153,975 (GRCm39) G25S probably damaging Het
P2ry2 G A 7: 100,647,228 (GRCm39) T359I probably damaging Het
Pbxip1 T A 3: 89,352,864 (GRCm39) V170E probably benign Het
Pcdhb20 T A 18: 37,639,146 (GRCm39) N557K probably damaging Het
Pdilt A G 7: 119,099,611 (GRCm39) V219A possibly damaging Het
Plec G T 15: 76,067,310 (GRCm39) S1149* probably null Het
Pnkp C T 7: 44,507,617 (GRCm39) T61I possibly damaging Het
Polr1f G T 12: 33,487,867 (GRCm39) E261* probably null Het
Prss56 T A 1: 87,115,749 (GRCm39) V541D probably damaging Het
Rab40c A G 17: 26,138,407 (GRCm39) V25A probably damaging Het
Rgs8 A T 1: 153,546,567 (GRCm39) H22L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Slc1a2 T C 2: 102,586,353 (GRCm39) V319A probably damaging Het
Sp140l2 G A 1: 85,224,671 (GRCm39) S288L possibly damaging Het
Spata18 A T 5: 73,828,572 (GRCm39) I378F probably damaging Het
Speer1i T A 5: 11,092,799 (GRCm39) Y79* probably null Het
Stag1 T C 9: 100,762,854 (GRCm39) V485A probably damaging Het
Tas2r104 T A 6: 131,662,569 (GRCm39) I47F probably damaging Het
Thumpd1 A T 7: 119,317,471 (GRCm39) H143Q possibly damaging Het
Tmem231 T C 8: 112,640,697 (GRCm39) Q272R probably damaging Het
Tnfaip2 A G 12: 111,412,310 (GRCm39) D237G probably benign Het
Tox3 T C 8: 91,074,543 (GRCm39) D12G probably benign Het
Vmn1r1 A G 1: 181,985,309 (GRCm39) S119P probably damaging Het
Xrn1 A G 9: 95,870,999 (GRCm39) E608G probably benign Het
Zfp395 T C 14: 65,629,528 (GRCm39) C281R probably damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCTTTCTCCATCCAAGAATCAC -3'
(R):5'- ACAGGGCATCATAGGCTGTC -3'

Sequencing Primer
(F):5'- ACTCTTAGTGATGGACTCCTACTCTG -3'
(R):5'- GGCTGTCTGCATATGAAATTCCAC -3'
Posted On 2021-08-31