Mutagenetix > Incidental Mutation

Incidental Mutation 'R0734:Med13'

68164

Institutional Source

Beutler Lab

Gene Symbol

Med13

Ensembl Gene

ENSMUSG00000034297

Gene Name

mediator complex subunit 13

Synonyms

Thrap1, 1110067M05Rik, Trap240

MMRRC Submission

038915-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R0734 (G1)

Quality Score

216

Status

Validated

Chromosome

Chromosomal Location

86267033-86357602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86301237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 861 (T861A)

Ref Sequence

ENSEMBL: ENSMUSP00000044268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043624]

AlphaFold

Q5SWW4

Predicted Effect

probably benign
Transcript: ENSMUST00000043624
AA Change: T861A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: T861A

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	384	5e-130	PFAM
low complexity region	438	451	N/A	INTRINSIC
low complexity region	531	540	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	984	998	N/A	INTRINSIC
low complexity region	1001	1029	N/A	INTRINSIC
low complexity region	1463	1476	N/A	INTRINSIC
low complexity region	1502	1517	N/A	INTRINSIC
low complexity region	1522	1550	N/A	INTRINSIC
low complexity region	1559	1570	N/A	INTRINSIC
low complexity region	1577	1596	N/A	INTRINSIC
Pfam:Med13_C	1637	2161	3.5e-146	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.0577

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.0%
20x: 93.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,850,334	S530T	probably benign	Het
Acer2	G	T	4: 86,917,559	K223N	probably benign	Het
Adam19	T	G	11: 46,127,403	C431G	probably damaging	Het
Adamts16	T	G	13: 70,738,481		probably benign	Het
Aox2	A	T	1: 58,305,341	E531V	probably benign	Het
Apaf1	A	T	10: 91,037,021	N720K	probably benign	Het
Atrnl1	T	A	19: 57,654,861	W394R	probably damaging	Het
Bcl6	T	C	16: 23,968,139	E634G	probably damaging	Het
Cfap65	T	A	1: 74,918,887	Y954F	probably damaging	Het
Cobl	A	G	11: 12,375,971	V168A	probably damaging	Het
Cped1	C	T	6: 22,085,041	P210S	probably damaging	Het
Crb1	C	T	1: 139,337,084	V199M	probably benign	Het
Cyp2j6	A	T	4: 96,523,844		probably benign	Het
Dhrs3	C	G	4: 144,927,176	S289W	probably damaging	Het
Dido1	T	G	2: 180,660,042	Q2023P	probably benign	Het
Dlg4	G	A	11: 70,042,705	G550R	probably damaging	Het
Dnah12	C	A	14: 26,800,013	H1928N	probably benign	Het
Dthd1	A	C	5: 62,839,410		probably benign	Het
Erg	C	A	16: 95,370,025	G269C	possibly damaging	Het
Erich6	G	A	3: 58,629,388		probably benign	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fancc	T	C	13: 63,331,842	R300G	probably damaging	Het
Fcer1g	T	A	1: 171,231,179	K47*	probably null	Het
Flt4	A	G	11: 49,626,717	T289A	possibly damaging	Het
Gcnt2	T	A	13: 40,860,521	F56Y	probably benign	Het
Gpatch8	G	T	11: 102,481,400	S437R	unknown	Het
Grin2a	T	A	16: 9,579,611	I871F	possibly damaging	Het
Hsd17b4	T	C	18: 50,170,777	V439A	possibly damaging	Het
Hykk	A	T	9: 54,946,432	K346M	possibly damaging	Het
Ifi208	T	C	1: 173,683,335	L352S	probably damaging	Het
Ikzf1	T	C	11: 11,758,195	V110A	probably damaging	Het
Irak3	A	T	10: 120,145,637		probably benign	Het
Lamp5	T	A	2: 136,059,030	V50E	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrch3	C	T	16: 32,997,483	R570*	probably null	Het
Map1lc3a	T	C	2: 155,276,976	V20A	possibly damaging	Het
Map3k14	C	A	11: 103,227,000	K655N	probably benign	Het
Mark2	A	G	19: 7,285,981		probably benign	Het
Mbtd1	G	A	11: 93,923,146	G205D	probably damaging	Het
Meltf	T	A	16: 31,881,958	Y99N	probably damaging	Het
Mex3d	G	A	10: 80,381,532	T617I	possibly damaging	Het
Muc13	G	A	16: 33,803,082	V249I	probably damaging	Het
Myo18a	C	A	11: 77,847,404	P1688Q	probably damaging	Het
Naaladl1	A	T	19: 6,112,874		probably null	Het
Ncoa3	T	A	2: 166,069,191		probably benign	Het
Nf2	T	C	11: 4,820,409	T67A	probably benign	Het
Nin	A	G	12: 70,030,113	V1056A	probably benign	Het
Olfr1426	T	A	19: 12,088,119	R224S	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr59	A	T	11: 74,288,946	Q100L	probably damaging	Het
P3h1	T	C	4: 119,238,688	L331P	probably damaging	Het
Pabpc4l	T	C	3: 46,446,973	K79E	possibly damaging	Het
Pam	T	A	1: 97,864,362	R445*	probably null	Het
Pcdhb6	T	C	18: 37,335,334	I436T	probably damaging	Het
Piezo2	A	G	18: 63,041,723	Y1987H	probably damaging	Het
Plch2	G	A	4: 154,996,283	T477I	probably damaging	Het
Postn	G	A	3: 54,362,715	G72R	probably damaging	Het
Proca1	G	A	11: 78,201,802		probably benign	Het
Psip1	T	A	4: 83,463,588		probably benign	Het
Ptprd	G	A	4: 76,140,597	P153L	probably damaging	Het
Rgl1	T	C	1: 152,554,300	D242G	probably damaging	Het
Ric1	T	A	19: 29,594,818	I671K	possibly damaging	Het
Rxrg	T	A	1: 167,627,444	C199S	probably damaging	Het
Sec24c	A	C	14: 20,693,745	D1006A	probably damaging	Het
Sec63	A	G	10: 42,796,208	T173A	probably benign	Het
Sfxn5	T	C	6: 85,267,865		probably benign	Het
Spam1	A	G	6: 24,796,949	I300V	probably benign	Het
Spem1	A	G	11: 69,821,271	L189P	probably damaging	Het
Sptbn2	A	T	19: 4,748,123	R1959*	probably null	Het
Timeless	C	T	10: 128,250,060	R935W	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim24	T	C	6: 37,919,465	Y286H	possibly damaging	Het
Ttyh2	A	G	11: 114,710,193		probably benign	Het
Zbtb21	C	T	16: 97,952,627	C180Y	probably damaging	Het
Zfp746	T	C	6: 48,064,899	T298A	probably damaging	Het

Other mutations in Med13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Med13	APN	11	86291040	splice site	probably benign
IGL01391:Med13	APN	11	86328497	missense	probably benign
IGL01767:Med13	APN	11	86319783	missense	probably benign	0.38
IGL01830:Med13	APN	11	86288928	splice site	probably benign
IGL01859:Med13	APN	11	86283751	missense	possibly damaging	0.86
IGL01924:Med13	APN	11	86308696	splice site	probably benign
IGL02080:Med13	APN	11	86283812	missense	probably damaging	0.97
IGL02138:Med13	APN	11	86286765	missense	probably damaging	0.99
IGL02259:Med13	APN	11	86357501	missense	possibly damaging	0.89
IGL02339:Med13	APN	11	86288939	missense	probably benign	0.16
IGL02399:Med13	APN	11	86283945	splice site	probably benign
IGL02646:Med13	APN	11	86283386	missense	probably benign	0.00
IGL03227:Med13	APN	11	86327792	splice site	probably benign
R0197_Med13_854	UTSW	11	86307038	missense	probably benign	0.13
R0360_Med13_060	UTSW	11	86329161	splice site	probably benign
R2359_Med13_079	UTSW	11	86291035	splice site	probably benign
R3735_Med13_085	UTSW	11	86279658	missense	probably benign	0.00
R4974_Med13_508	UTSW	11	86298847	missense	probably damaging	0.98
R0116:Med13	UTSW	11	86319897	missense	probably damaging	0.99
R0189:Med13	UTSW	11	86319876	missense	probably benign
R0197:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0206:Med13	UTSW	11	86300856	splice site	probably benign
R0208:Med13	UTSW	11	86300856	splice site	probably benign
R0310:Med13	UTSW	11	86346003	missense	probably benign	0.11
R0360:Med13	UTSW	11	86329161	splice site	probably benign
R0413:Med13	UTSW	11	86299207	splice site	probably benign
R0482:Med13	UTSW	11	86285151	missense	probably benign	0.41
R0497:Med13	UTSW	11	86276983	splice site	probably benign
R0589:Med13	UTSW	11	86283249	missense	probably damaging	1.00
R0601:Med13	UTSW	11	86345962	missense	possibly damaging	0.47
R0646:Med13	UTSW	11	86331089	missense	possibly damaging	0.95
R0701:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0709:Med13	UTSW	11	86319596	missense	possibly damaging	0.95
R0711:Med13	UTSW	11	86301353	splice site	probably benign
R0883:Med13	UTSW	11	86307038	missense	probably benign	0.13
R1793:Med13	UTSW	11	86329351	missense	probably benign	0.45
R1926:Med13	UTSW	11	86289073	missense	possibly damaging	0.47
R1959:Med13	UTSW	11	86298979	missense	probably damaging	1.00
R2286:Med13	UTSW	11	86319689	missense	probably benign	0.05
R2359:Med13	UTSW	11	86291035	splice site	probably benign
R2444:Med13	UTSW	11	86331960	missense	probably damaging	1.00
R2679:Med13	UTSW	11	86298577	missense	probably benign	0.00
R2879:Med13	UTSW	11	86299162	missense	possibly damaging	0.61
R3439:Med13	UTSW	11	86285297	missense	probably damaging	1.00
R3735:Med13	UTSW	11	86279658	missense	probably benign	0.00
R4333:Med13	UTSW	11	86288183	missense	probably benign
R4558:Med13	UTSW	11	86299054	missense	probably damaging	1.00
R4598:Med13	UTSW	11	86278566	missense	probably damaging	0.97
R4773:Med13	UTSW	11	86276920	missense	probably damaging	0.99
R4801:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4802:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4806:Med13	UTSW	11	86298577	missense	probably benign	0.00
R4940:Med13	UTSW	11	86288118	missense	probably damaging	1.00
R4974:Med13	UTSW	11	86298847	missense	probably damaging	0.98
R5056:Med13	UTSW	11	86328565	missense	probably benign	0.00
R5133:Med13	UTSW	11	86319849	missense	probably benign	0.32
R5206:Med13	UTSW	11	86319879	missense	probably damaging	1.00
R5352:Med13	UTSW	11	86301468	missense	possibly damaging	0.82
R5534:Med13	UTSW	11	86319365	missense	probably benign	0.09
R5556:Med13	UTSW	11	86327838	missense	probably benign	0.25
R5633:Med13	UTSW	11	86278931	splice site	probably benign
R5769:Med13	UTSW	11	86346003	missense	probably benign	0.11
R6236:Med13	UTSW	11	86328531	missense	probably damaging	0.99
R6479:Med13	UTSW	11	86357527	start gained	probably benign
R6487:Med13	UTSW	11	86331150	missense	probably damaging	1.00
R6524:Med13	UTSW	11	86301467	missense	probably damaging	0.98
R6528:Med13	UTSW	11	86298954	missense	probably damaging	1.00
R6805:Med13	UTSW	11	86278796	missense	possibly damaging	0.48
R6913:Med13	UTSW	11	86319876	missense	probably benign
R7221:Med13	UTSW	11	86288095	missense	probably benign	0.00
R7254:Med13	UTSW	11	86319835	missense	probably benign
R7267:Med13	UTSW	11	86308826	missense	probably benign	0.01
R7309:Med13	UTSW	11	86291062	missense	probably benign	0.00
R7404:Med13	UTSW	11	86286446	missense	possibly damaging	0.53
R7586:Med13	UTSW	11	86271002	missense	probably damaging	0.99
R7704:Med13	UTSW	11	86345918	nonsense	probably null
R7922:Med13	UTSW	11	86271005	missense	probably damaging	0.98
R7943:Med13	UTSW	11	86278526	missense	probably damaging	0.97
R8062:Med13	UTSW	11	86319438	missense	probably benign
R8075:Med13	UTSW	11	86272470	missense	probably damaging	0.98
R8207:Med13	UTSW	11	86303549	missense	probably damaging	1.00
R8671:Med13	UTSW	11	86271097	missense	probably damaging	1.00
R9056:Med13	UTSW	11	86298834	nonsense	probably null
R9084:Med13	UTSW	11	86300795	missense	probably damaging	1.00
R9148:Med13	UTSW	11	86301471	missense	probably benign	0.27
R9329:Med13	UTSW	11	86298457	missense	probably benign	0.10
R9380:Med13	UTSW	11	86286772	missense	probably benign	0.42
R9515:Med13	UTSW	11	86308901	missense	probably benign	0.00
R9516:Med13	UTSW	11	86288975	missense	probably benign	0.01
R9690:Med13	UTSW	11	86278844	missense	probably damaging	1.00
R9751:Med13	UTSW	11	86299158	missense	probably damaging	1.00
R9752:Med13	UTSW	11	86283321	missense	possibly damaging	0.87
R9764:Med13	UTSW	11	86286519	missense	possibly damaging	0.89
Z1176:Med13	UTSW	11	86328544	missense	possibly damaging	0.91
Z1176:Med13	UTSW	11	86345862	missense	probably benign	0.45
Z1176:Med13	UTSW	11	86355423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATAGTGGTCCCACAATTCCCTCC -3'
(R):5'- ACTTACCAATGCACTCCAGTGATGG -3'

Sequencing Primer
(F):5'- TAGCCATAACACTAAAATCAACTGTG -3'
(R):5'- CCGTTGTCCTGCATAAGTAAG -3'

Posted On

2013-09-03