Incidental Mutation 'R0734:Mbtd1'
ID68165
Institutional Source Beutler Lab
Gene Symbol Mbtd1
Ensembl Gene ENSMUSG00000059474
Gene Namembt domain containing 1
Synonymshemp
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0734 (G1)
Quality Score202
Status Validated
Chromosome11
Chromosomal Location93885852-93946985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93923146 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 205 (G205D)
Ref Sequence ENSEMBL: ENSMUSP00000103486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107850] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]
Predicted Effect probably damaging
Transcript: ENSMUST00000063645
AA Change: G205D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474
AA Change: G205D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063718
AA Change: G227D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: G227D

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107850
SMART Domains Protein: ENSMUSP00000103482
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Blast:MBT 25 52 2e-9 BLAST
PDB:2W0T|A 52 74 2e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
PDB:4C5I|B 131 201 5e-37 PDB
Blast:MBT 144 201 1e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107852
AA Change: G205D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474
AA Change: G205D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 5e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 433 1.29e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107853
AA Change: G205D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: G205D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107854
AA Change: G205D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: G205D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155841
Meta Mutation Damage Score 0.9051 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Mbtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Mbtd1 APN 11 93943840 missense possibly damaging 0.94
IGL00819:Mbtd1 APN 11 93931811 critical splice acceptor site probably null
IGL01140:Mbtd1 APN 11 93924432 missense probably damaging 1.00
IGL01553:Mbtd1 APN 11 93923214 missense probably benign 0.35
IGL01893:Mbtd1 APN 11 93921412 missense probably null
IGL02218:Mbtd1 APN 11 93931803 splice site probably benign
IGL02406:Mbtd1 APN 11 93908858 missense probably damaging 1.00
IGL03002:Mbtd1 APN 11 93924490 missense probably benign 0.15
IGL03347:Mbtd1 APN 11 93923179 missense probably benign 0.01
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0311:Mbtd1 UTSW 11 93921357 splice site probably null
R0513:Mbtd1 UTSW 11 93932212 splice site probably null
R0646:Mbtd1 UTSW 11 93905212 missense probably damaging 1.00
R0835:Mbtd1 UTSW 11 93931839 missense probably benign 0.23
R1295:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1296:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1996:Mbtd1 UTSW 11 93932396 frame shift probably null
R2157:Mbtd1 UTSW 11 93910388 missense probably benign 0.20
R3977:Mbtd1 UTSW 11 93905175 missense probably benign
R4435:Mbtd1 UTSW 11 93932222 missense probably benign
R4589:Mbtd1 UTSW 11 93921419 missense probably damaging 1.00
R4647:Mbtd1 UTSW 11 93924611 missense probably damaging 1.00
R4824:Mbtd1 UTSW 11 93925702 missense probably benign 0.00
R4919:Mbtd1 UTSW 11 93923148 unclassified probably null
R5045:Mbtd1 UTSW 11 93931815 missense probably benign 0.26
R5095:Mbtd1 UTSW 11 93929671 missense probably damaging 1.00
R5227:Mbtd1 UTSW 11 93924648 missense possibly damaging 0.54
R5619:Mbtd1 UTSW 11 93929879 intron probably null
R6057:Mbtd1 UTSW 11 93929659 missense probably damaging 0.99
R6293:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6294:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6295:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6297:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6998:Mbtd1 UTSW 11 93924612 missense probably damaging 1.00
R7423:Mbtd1 UTSW 11 93943796 missense probably benign 0.38
R7519:Mbtd1 UTSW 11 93908899 missense probably damaging 1.00
X0024:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
Z1177:Mbtd1 UTSW 11 93912459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTATGCTCTGAAGCGTTGTCTTT -3'
(R):5'- TGACCATGAGGCCACTCACTTCTA -3'

Sequencing Primer
(F):5'- GGGACTTACAGATTTTCCACAC -3'
(R):5'- TTTTCCACTAGCTGCACACC -3'
Posted On2013-09-03