Mutagenetix > Incidental Mutation

Incidental Mutation 'R0734:Nin'

68168

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

038915-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70030113 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1056 (V1056A)

Ref Sequence

ENSEMBL: ENSMUSP00000152530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably benign
Transcript: ENSMUST00000021468
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: V1763A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085314
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: V1763A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095666
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: V1763A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169074
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: V1763A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220689
AA Change: V1056A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

probably benign
Transcript: ENSMUST00000221579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222137

Predicted Effect

probably benign
Transcript: ENSMUST00000222237
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000222835

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223048

Predicted Effect

probably benign
Transcript: ENSMUST00000223257
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223469

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.0%
20x: 93.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,850,334	S530T	probably benign	Het
Acer2	G	T	4: 86,917,559	K223N	probably benign	Het
Adam19	T	G	11: 46,127,403	C431G	probably damaging	Het
Adamts16	T	G	13: 70,738,481		probably benign	Het
Aox2	A	T	1: 58,305,341	E531V	probably benign	Het
Apaf1	A	T	10: 91,037,021	N720K	probably benign	Het
Atrnl1	T	A	19: 57,654,861	W394R	probably damaging	Het
Bcl6	T	C	16: 23,968,139	E634G	probably damaging	Het
Cfap65	T	A	1: 74,918,887	Y954F	probably damaging	Het
Cobl	A	G	11: 12,375,971	V168A	probably damaging	Het
Cped1	C	T	6: 22,085,041	P210S	probably damaging	Het
Crb1	C	T	1: 139,337,084	V199M	probably benign	Het
Cyp2j6	A	T	4: 96,523,844		probably benign	Het
Dhrs3	C	G	4: 144,927,176	S289W	probably damaging	Het
Dido1	T	G	2: 180,660,042	Q2023P	probably benign	Het
Dlg4	G	A	11: 70,042,705	G550R	probably damaging	Het
Dnah12	C	A	14: 26,800,013	H1928N	probably benign	Het
Dthd1	A	C	5: 62,839,410		probably benign	Het
Erg	C	A	16: 95,370,025	G269C	possibly damaging	Het
Erich6	G	A	3: 58,629,388		probably benign	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fancc	T	C	13: 63,331,842	R300G	probably damaging	Het
Fcer1g	T	A	1: 171,231,179	K47*	probably null	Het
Flt4	A	G	11: 49,626,717	T289A	possibly damaging	Het
Gcnt2	T	A	13: 40,860,521	F56Y	probably benign	Het
Gpatch8	G	T	11: 102,481,400	S437R	unknown	Het
Grin2a	T	A	16: 9,579,611	I871F	possibly damaging	Het
Hsd17b4	T	C	18: 50,170,777	V439A	possibly damaging	Het
Hykk	A	T	9: 54,946,432	K346M	possibly damaging	Het
Ifi208	T	C	1: 173,683,335	L352S	probably damaging	Het
Ikzf1	T	C	11: 11,758,195	V110A	probably damaging	Het
Irak3	A	T	10: 120,145,637		probably benign	Het
Lamp5	T	A	2: 136,059,030	V50E	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrch3	C	T	16: 32,997,483	R570*	probably null	Het
Map1lc3a	T	C	2: 155,276,976	V20A	possibly damaging	Het
Map3k14	C	A	11: 103,227,000	K655N	probably benign	Het
Mark2	A	G	19: 7,285,981		probably benign	Het
Mbtd1	G	A	11: 93,923,146	G205D	probably damaging	Het
Med13	T	C	11: 86,301,237	T861A	probably benign	Het
Meltf	T	A	16: 31,881,958	Y99N	probably damaging	Het
Mex3d	G	A	10: 80,381,532	T617I	possibly damaging	Het
Muc13	G	A	16: 33,803,082	V249I	probably damaging	Het
Myo18a	C	A	11: 77,847,404	P1688Q	probably damaging	Het
Naaladl1	A	T	19: 6,112,874		probably null	Het
Ncoa3	T	A	2: 166,069,191		probably benign	Het
Nf2	T	C	11: 4,820,409	T67A	probably benign	Het
Olfr1426	T	A	19: 12,088,119	R224S	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr59	A	T	11: 74,288,946	Q100L	probably damaging	Het
P3h1	T	C	4: 119,238,688	L331P	probably damaging	Het
Pabpc4l	T	C	3: 46,446,973	K79E	possibly damaging	Het
Pam	T	A	1: 97,864,362	R445*	probably null	Het
Pcdhb6	T	C	18: 37,335,334	I436T	probably damaging	Het
Piezo2	A	G	18: 63,041,723	Y1987H	probably damaging	Het
Plch2	G	A	4: 154,996,283	T477I	probably damaging	Het
Postn	G	A	3: 54,362,715	G72R	probably damaging	Het
Proca1	G	A	11: 78,201,802		probably benign	Het
Psip1	T	A	4: 83,463,588		probably benign	Het
Ptprd	G	A	4: 76,140,597	P153L	probably damaging	Het
Rgl1	T	C	1: 152,554,300	D242G	probably damaging	Het
Ric1	T	A	19: 29,594,818	I671K	possibly damaging	Het
Rxrg	T	A	1: 167,627,444	C199S	probably damaging	Het
Sec24c	A	C	14: 20,693,745	D1006A	probably damaging	Het
Sec63	A	G	10: 42,796,208	T173A	probably benign	Het
Sfxn5	T	C	6: 85,267,865		probably benign	Het
Spam1	A	G	6: 24,796,949	I300V	probably benign	Het
Spem1	A	G	11: 69,821,271	L189P	probably damaging	Het
Sptbn2	A	T	19: 4,748,123	R1959*	probably null	Het
Timeless	C	T	10: 128,250,060	R935W	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim24	T	C	6: 37,919,465	Y286H	possibly damaging	Het
Ttyh2	A	G	11: 114,710,193		probably benign	Het
Zbtb21	C	T	16: 97,952,627	C180Y	probably damaging	Het
Zfp746	T	C	6: 48,064,899	T298A	probably damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
R9496:Nin	UTSW	12	70055988	missense
R9638:Nin	UTSW	12	70020844	missense
R9709:Nin	UTSW	12	70102694	missense
R9745:Nin	UTSW	12	70043125	missense
R9792:Nin	UTSW	12	70047235	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- TGGTTCAGAAGCAAACATCCCTGAC -3'
(R):5'- GCATACGAAGCACCCTGAGTTTCC -3'

Sequencing Primer
(F):5'- atatagagagagagagagagagagG -3'
(R):5'- GTTTCCACTGAACTGCTGGAAAG -3'

Posted On

2013-09-03