Incidental Mutation 'R0734:Nin'
ID 68168
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 038915-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0734 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 70058209-70160491 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70076887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1056 (V1056A)
Ref Sequence ENSEMBL: ENSMUSP00000152530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000223257] [ENSMUST00000222835]
AlphaFold Q61043
Predicted Effect probably benign
Transcript: ENSMUST00000021468
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: V1763A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085314
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: V1763A

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095666
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: V1763A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169074
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: V1763A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
AA Change: V1056A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably benign
Transcript: ENSMUST00000221579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222137
Predicted Effect probably benign
Transcript: ENSMUST00000222237
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223257
AA Change: V1763A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223048
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223469
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,668,198 (GRCm39) S530T probably benign Het
Acer2 G T 4: 86,835,796 (GRCm39) K223N probably benign Het
Adam19 T G 11: 46,018,230 (GRCm39) C431G probably damaging Het
Adamts16 T G 13: 70,886,600 (GRCm39) probably benign Het
Aox1 A T 1: 58,344,500 (GRCm39) E531V probably benign Het
Apaf1 A T 10: 90,872,883 (GRCm39) N720K probably benign Het
Atrnl1 T A 19: 57,643,293 (GRCm39) W394R probably damaging Het
Bcl6 T C 16: 23,786,889 (GRCm39) E634G probably damaging Het
Cfap65 T A 1: 74,958,046 (GRCm39) Y954F probably damaging Het
Cobl A G 11: 12,325,971 (GRCm39) V168A probably damaging Het
Cped1 C T 6: 22,085,040 (GRCm39) P210S probably damaging Het
Crb1 C T 1: 139,264,822 (GRCm39) V199M probably benign Het
Cyp2j6 A T 4: 96,412,081 (GRCm39) probably benign Het
Dhrs3 C G 4: 144,653,746 (GRCm39) S289W probably damaging Het
Dido1 T G 2: 180,301,835 (GRCm39) Q2023P probably benign Het
Dlg4 G A 11: 69,933,531 (GRCm39) G550R probably damaging Het
Dnah12 C A 14: 26,521,970 (GRCm39) H1928N probably benign Het
Dthd1 A C 5: 62,996,753 (GRCm39) probably benign Het
Erg C A 16: 95,170,884 (GRCm39) G269C possibly damaging Het
Erich6 G A 3: 58,536,809 (GRCm39) probably benign Het
F5 G C 1: 164,026,486 (GRCm39) R1686P probably damaging Het
Fancc T C 13: 63,479,656 (GRCm39) R300G probably damaging Het
Fcer1g T A 1: 171,058,748 (GRCm39) K47* probably null Het
Flt4 A G 11: 49,517,544 (GRCm39) T289A possibly damaging Het
Gcnt2 T A 13: 41,013,997 (GRCm39) F56Y probably benign Het
Gpatch8 G T 11: 102,372,226 (GRCm39) S437R unknown Het
Grin2a T A 16: 9,397,475 (GRCm39) I871F possibly damaging Het
Hsd17b4 T C 18: 50,303,844 (GRCm39) V439A possibly damaging Het
Hykk A T 9: 54,853,716 (GRCm39) K346M possibly damaging Het
Ifi208 T C 1: 173,510,901 (GRCm39) L352S probably damaging Het
Ikzf1 T C 11: 11,708,195 (GRCm39) V110A probably damaging Het
Irak3 A T 10: 119,981,542 (GRCm39) probably benign Het
Lamp5 T A 2: 135,900,950 (GRCm39) V50E probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lrch3 C T 16: 32,817,853 (GRCm39) R570* probably null Het
Map1lc3a T C 2: 155,118,896 (GRCm39) V20A possibly damaging Het
Map3k14 C A 11: 103,117,826 (GRCm39) K655N probably benign Het
Mark2 A G 19: 7,263,346 (GRCm39) probably benign Het
Mbtd1 G A 11: 93,813,972 (GRCm39) G205D probably damaging Het
Med13 T C 11: 86,192,063 (GRCm39) T861A probably benign Het
Meltf T A 16: 31,700,776 (GRCm39) Y99N probably damaging Het
Mex3d G A 10: 80,217,366 (GRCm39) T617I possibly damaging Het
Muc13 G A 16: 33,623,452 (GRCm39) V249I probably damaging Het
Myo18a C A 11: 77,738,230 (GRCm39) P1688Q probably damaging Het
Naaladl1 A T 19: 6,162,904 (GRCm39) probably null Het
Ncoa3 T A 2: 165,911,111 (GRCm39) probably benign Het
Nf2 T C 11: 4,770,409 (GRCm39) T67A probably benign Het
Or1p1 A T 11: 74,179,772 (GRCm39) Q100L probably damaging Het
Or4d10c T A 19: 12,065,483 (GRCm39) R224S probably benign Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
P3h1 T C 4: 119,095,885 (GRCm39) L331P probably damaging Het
Pabpc4l T C 3: 46,401,408 (GRCm39) K79E possibly damaging Het
Pam T A 1: 97,792,087 (GRCm39) R445* probably null Het
Pcdhb6 T C 18: 37,468,387 (GRCm39) I436T probably damaging Het
Piezo2 A G 18: 63,174,794 (GRCm39) Y1987H probably damaging Het
Plch2 G A 4: 155,080,740 (GRCm39) T477I probably damaging Het
Postn G A 3: 54,270,136 (GRCm39) G72R probably damaging Het
Proca1 G A 11: 78,092,628 (GRCm39) probably benign Het
Psip1 T A 4: 83,381,825 (GRCm39) probably benign Het
Ptprd G A 4: 76,058,834 (GRCm39) P153L probably damaging Het
Rgl1 T C 1: 152,430,051 (GRCm39) D242G probably damaging Het
Ric1 T A 19: 29,572,218 (GRCm39) I671K possibly damaging Het
Rxrg T A 1: 167,455,013 (GRCm39) C199S probably damaging Het
Sec24c A C 14: 20,743,813 (GRCm39) D1006A probably damaging Het
Sec63 A G 10: 42,672,204 (GRCm39) T173A probably benign Het
Sfxn5 T C 6: 85,244,847 (GRCm39) probably benign Het
Spam1 A G 6: 24,796,948 (GRCm39) I300V probably benign Het
Spem1 A G 11: 69,712,097 (GRCm39) L189P probably damaging Het
Sptbn2 A T 19: 4,798,151 (GRCm39) R1959* probably null Het
Timeless C T 10: 128,085,929 (GRCm39) R935W probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trim24 T C 6: 37,896,400 (GRCm39) Y286H possibly damaging Het
Ttyh2 A G 11: 114,601,019 (GRCm39) probably benign Het
Zbtb21 C T 16: 97,753,827 (GRCm39) C180Y probably damaging Het
Zfp746 T C 6: 48,041,833 (GRCm39) T298A probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,076,862 (GRCm39) missense probably damaging 0.98
IGL00677:Nin APN 12 70,073,634 (GRCm39) missense probably damaging 1.00
IGL00823:Nin APN 12 70,061,567 (GRCm39) missense probably benign 0.01
IGL01103:Nin APN 12 70,103,532 (GRCm39) missense probably damaging 0.99
IGL01113:Nin APN 12 70,078,553 (GRCm39) missense probably damaging 1.00
IGL01420:Nin APN 12 70,092,188 (GRCm39) missense probably benign 0.08
IGL01556:Nin APN 12 70,089,962 (GRCm39) missense probably benign 0.01
IGL01663:Nin APN 12 70,090,439 (GRCm39) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,109,473 (GRCm39) nonsense probably null
IGL02030:Nin APN 12 70,092,042 (GRCm39) missense probably damaging 1.00
IGL02202:Nin APN 12 70,102,210 (GRCm39) missense probably damaging 1.00
IGL02207:Nin APN 12 70,103,431 (GRCm39) missense probably damaging 0.99
IGL02257:Nin APN 12 70,149,465 (GRCm39) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,090,805 (GRCm39) missense probably damaging 1.00
IGL02531:Nin APN 12 70,067,706 (GRCm39) missense probably benign 0.02
IGL03028:Nin APN 12 70,082,044 (GRCm39) missense probably benign 0.13
IGL03155:Nin APN 12 70,078,544 (GRCm39) missense probably damaging 1.00
IGL03197:Nin APN 12 70,073,584 (GRCm39) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,103,512 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0132:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0947:Nin UTSW 12 70,107,960 (GRCm39) missense probably damaging 1.00
R1085:Nin UTSW 12 70,067,736 (GRCm39) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,090,703 (GRCm39) missense probably damaging 0.99
R1452:Nin UTSW 12 70,064,424 (GRCm39) nonsense probably null
R1477:Nin UTSW 12 70,090,958 (GRCm39) missense possibly damaging 0.87
R1518:Nin UTSW 12 70,061,547 (GRCm39) missense probably benign 0.27
R1566:Nin UTSW 12 70,101,253 (GRCm39) missense probably damaging 0.99
R1572:Nin UTSW 12 70,085,524 (GRCm39) missense probably damaging 1.00
R1583:Nin UTSW 12 70,078,512 (GRCm39) missense probably benign
R1584:Nin UTSW 12 70,089,443 (GRCm39) missense probably benign 0.03
R1699:Nin UTSW 12 70,092,337 (GRCm39) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,077,712 (GRCm39) missense probably benign 0.40
R1765:Nin UTSW 12 70,089,665 (GRCm39) missense probably damaging 1.00
R1794:Nin UTSW 12 70,090,569 (GRCm39) nonsense probably null
R1952:Nin UTSW 12 70,077,700 (GRCm39) missense probably damaging 1.00
R2004:Nin UTSW 12 70,072,251 (GRCm39) missense probably benign 0.01
R2025:Nin UTSW 12 70,076,782 (GRCm39) missense probably damaging 1.00
R2060:Nin UTSW 12 70,089,192 (GRCm39) missense possibly damaging 0.64
R2213:Nin UTSW 12 70,092,128 (GRCm39) missense probably damaging 1.00
R2224:Nin UTSW 12 70,108,004 (GRCm39) missense probably damaging 1.00
R2247:Nin UTSW 12 70,101,319 (GRCm39) missense probably damaging 1.00
R2972:Nin UTSW 12 70,109,487 (GRCm39) missense probably damaging 1.00
R3776:Nin UTSW 12 70,085,456 (GRCm39) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,089,315 (GRCm39) missense probably benign 0.00
R3930:Nin UTSW 12 70,125,016 (GRCm39) missense probably damaging 1.00
R3959:Nin UTSW 12 70,097,526 (GRCm39) missense probably damaging 1.00
R4229:Nin UTSW 12 70,097,984 (GRCm39) missense probably damaging 0.99
R4359:Nin UTSW 12 70,061,712 (GRCm39) missense probably benign 0.00
R4423:Nin UTSW 12 70,089,752 (GRCm39) missense probably damaging 1.00
R4461:Nin UTSW 12 70,089,359 (GRCm39) missense probably benign 0.37
R4639:Nin UTSW 12 70,085,375 (GRCm39) missense probably damaging 0.97
R4791:Nin UTSW 12 70,090,581 (GRCm39) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,137,325 (GRCm39) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,090,837 (GRCm39) missense probably damaging 1.00
R5712:Nin UTSW 12 70,089,543 (GRCm39) missense probably damaging 1.00
R5726:Nin UTSW 12 70,124,953 (GRCm39) missense probably damaging 1.00
R5804:Nin UTSW 12 70,092,375 (GRCm39) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,077,692 (GRCm39) missense possibly damaging 0.94
R5992:Nin UTSW 12 70,092,298 (GRCm39) missense possibly damaging 0.83
R6077:Nin UTSW 12 70,066,006 (GRCm39) missense probably damaging 1.00
R6184:Nin UTSW 12 70,090,511 (GRCm39) missense probably damaging 1.00
R6307:Nin UTSW 12 70,061,631 (GRCm39) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,092,389 (GRCm39) missense probably damaging 1.00
R6326:Nin UTSW 12 70,091,955 (GRCm39) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,101,308 (GRCm39) missense probably benign 0.22
R6562:Nin UTSW 12 70,102,728 (GRCm39) missense probably damaging 1.00
R6578:Nin UTSW 12 70,107,968 (GRCm39) missense probably damaging 0.99
R6613:Nin UTSW 12 70,077,728 (GRCm39) missense probably damaging 1.00
R7112:Nin UTSW 12 70,149,573 (GRCm39) missense
R7170:Nin UTSW 12 70,091,013 (GRCm39) missense
R7324:Nin UTSW 12 70,090,508 (GRCm39) missense
R7338:Nin UTSW 12 70,090,838 (GRCm39) missense
R7372:Nin UTSW 12 70,102,803 (GRCm39) missense
R7431:Nin UTSW 12 70,124,997 (GRCm39) missense
R7577:Nin UTSW 12 70,109,480 (GRCm39) missense
R7655:Nin UTSW 12 70,089,542 (GRCm39) missense
R7656:Nin UTSW 12 70,089,542 (GRCm39) missense
R7683:Nin UTSW 12 70,124,956 (GRCm39) missense
R7769:Nin UTSW 12 70,090,004 (GRCm39) missense
R7981:Nin UTSW 12 70,089,591 (GRCm39) missense
R8138:Nin UTSW 12 70,089,672 (GRCm39) missense
R8141:Nin UTSW 12 70,076,795 (GRCm39) missense
R8754:Nin UTSW 12 70,077,787 (GRCm39) intron probably benign
R8790:Nin UTSW 12 70,067,793 (GRCm39) missense
R8899:Nin UTSW 12 70,077,710 (GRCm39) missense probably damaging 1.00
R8974:Nin UTSW 12 70,124,932 (GRCm39) missense
R9085:Nin UTSW 12 70,076,786 (GRCm39) nonsense probably null
R9143:Nin UTSW 12 70,137,349 (GRCm39) missense
R9380:Nin UTSW 12 70,074,805 (GRCm39) missense
R9496:Nin UTSW 12 70,102,762 (GRCm39) missense
R9638:Nin UTSW 12 70,067,618 (GRCm39) missense
R9709:Nin UTSW 12 70,149,468 (GRCm39) missense
R9745:Nin UTSW 12 70,089,899 (GRCm39) missense
R9792:Nin UTSW 12 70,094,009 (GRCm39) missense
Z1176:Nin UTSW 12 70,095,938 (GRCm39) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,101,200 (GRCm39) missense
Z1177:Nin UTSW 12 70,090,869 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGGTTCAGAAGCAAACATCCCTGAC -3'
(R):5'- GCATACGAAGCACCCTGAGTTTCC -3'

Sequencing Primer
(F):5'- atatagagagagagagagagagagG -3'
(R):5'- GTTTCCACTGAACTGCTGGAAAG -3'
Posted On 2013-09-03