Incidental Mutation 'R8951:Ndst1'
ID 681680
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene Name N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8951 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 60685978-60713389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60697124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 638 (E638G)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
AlphaFold Q3UHN9
Predicted Effect probably benign
Transcript: ENSMUST00000169273
AA Change: E638G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: E638G

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 T C 11: 102,774,367 probably null Het
Adcy6 A T 15: 98,604,259 V158E possibly damaging Het
Adgrg3 T C 8: 95,034,734 probably benign Het
Arsb T C 13: 93,807,616 S272P probably damaging Het
Asb10 A C 5: 24,537,954 C260W probably damaging Het
Atp13a1 A G 8: 69,793,834 D158G probably benign Het
Bcl6 T C 16: 23,974,954 E81G probably damaging Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
C7 A T 15: 5,002,749 V660E probably benign Het
Cacna1c T C 6: 118,613,339 D1401G probably damaging Het
Ccp110 A G 7: 118,721,792 I223M possibly damaging Het
Cilp A G 9: 65,272,938 E187G probably benign Het
Cmc2 T C 8: 116,911,165 N15S probably damaging Het
Cnnm3 T A 1: 36,518,938 probably benign Het
Col27a1 T G 4: 63,273,074 M828R possibly damaging Het
Cpm C T 10: 117,676,033 P294L probably damaging Het
Cpt1a G C 19: 3,362,211 A228P probably benign Het
Ctbp1 A G 5: 33,259,335 V43A probably damaging Het
Cylc2 A T 4: 51,229,469 E270D unknown Het
Cyp46a1 A C 12: 108,346,089 R119S possibly damaging Het
Dctn3 A T 4: 41,719,845 I87N probably damaging Het
Dhdds C T 4: 133,992,546 V25I possibly damaging Het
Entpd1 A C 19: 40,738,875 N489T probably damaging Het
Fam110a T C 2: 151,970,541 D103G probably damaging Het
Foxo6 T A 4: 120,267,936 Q554L unknown Het
Gbp5 T A 3: 142,500,720 M55K probably damaging Het
Gm20730 T C 6: 43,081,704 Y58C possibly damaging Het
Gm8871 T A 5: 11,042,832 Y79* probably null Het
Grip1 T A 10: 120,038,604 S679T possibly damaging Het
Gtdc1 A C 2: 44,789,018 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igha T A 12: 113,259,064 N246Y Het
Ighg2b T A 12: 113,307,306 T104S probably benign Het
Ighmbp2 C T 19: 3,268,726 W450* probably null Het
Ipo11 T C 13: 106,842,182 E839G possibly damaging Het
Iqce T C 5: 140,689,823 D207G probably damaging Het
Irgm2 T C 11: 58,219,582 V45A possibly damaging Het
Itga1 C T 13: 114,970,491 W1021* probably null Het
Itga3 T C 11: 95,054,085 Y799C probably damaging Het
Klf1 T C 8: 84,903,283 S246P possibly damaging Het
Kras A T 6: 145,220,612 M188K probably benign Het
Lacc1 C T 14: 77,035,173 C61Y probably benign Het
Lect2 T A 13: 56,543,009 probably benign Het
Leng9 G A 7: 4,149,783 probably benign Het
Lhx9 A G 1: 138,841,966 C6R probably damaging Het
Matn3 T A 12: 8,952,172 I128K probably damaging Het
Nell2 A T 15: 95,241,543 C603S probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Oas1h T G 5: 120,862,594 F89C probably damaging Het
Olfr1175-ps C T 2: 88,323,631 G25S probably damaging Het
Olfr1426 A T 19: 12,088,692 Y33* probably null Het
Olfr1453 T A 19: 13,027,463 S289C Het
Olfr685 A G 7: 105,180,431 V294A probably damaging Het
P2ry2 G A 7: 100,998,021 T359I probably damaging Het
Pbxip1 T A 3: 89,445,557 V170E probably benign Het
Pcdhb20 T A 18: 37,506,093 N557K probably damaging Het
Pdilt A G 7: 119,500,388 V219A possibly damaging Het
Plec G T 15: 76,183,110 S1149* probably null Het
Pnkp C T 7: 44,858,193 T61I possibly damaging Het
Prss56 T A 1: 87,188,027 V541D probably damaging Het
Rab40c A G 17: 25,919,433 V25A probably damaging Het
Rgs8 A T 1: 153,670,821 H22L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc1a2 T C 2: 102,756,008 V319A probably damaging Het
Spata18 A T 5: 73,671,229 I378F probably damaging Het
Stag1 T C 9: 100,880,801 V485A probably damaging Het
Tas2r104 T A 6: 131,685,606 I47F probably damaging Het
Thumpd1 A T 7: 119,718,248 H143Q possibly damaging Het
Tmem231 T C 8: 111,914,065 Q272R probably damaging Het
Tnfaip2 A G 12: 111,445,876 D237G probably benign Het
Tox3 T C 8: 90,347,915 D12G probably benign Het
Twistnb G T 12: 33,437,868 E261* probably null Het
Vmn1r1 A G 1: 182,157,744 S119P probably damaging Het
Xrn1 A G 9: 95,988,946 E608G probably benign Het
Zfp395 T C 14: 65,392,079 C281R probably damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
R8918:Ndst1 UTSW 18 60692011 missense probably benign 0.00
R9187:Ndst1 UTSW 18 60691196 missense probably benign 0.03
R9374:Ndst1 UTSW 18 60712859 missense probably damaging 0.97
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCATGACTCACTGTGCCTTG -3'
(R):5'- TGAGGGAGCTAAGACTCCAGAC -3'

Sequencing Primer
(F):5'- CCTGTTTATAGGAATCTCAGCCGAG -3'
(R):5'- CCAGACGGGAAGGGGTTTTC -3'
Posted On 2021-08-31