Incidental Mutation 'R8952:Nos2'
ID 681717
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8952 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78945263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 384 (N384S)
Ref Sequence ENSEMBL: ENSMUSP00000150558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
Predicted Effect probably benign
Transcript: ENSMUST00000018610
AA Change: N497S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: N497S

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214397
AA Change: N384S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,285,979 N758S probably damaging Het
Asb3 C A 11: 31,058,959 Q287K probably damaging Het
Bach1 T A 16: 87,715,465 N25K probably damaging Het
BC024978 T A 7: 27,200,600 S134T probably damaging Het
Carmil2 T A 8: 105,690,766 V552E possibly damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dock3 A G 9: 106,973,759 F848S probably benign Het
Dytn G A 1: 63,658,952 R299C Het
Fbxl18 C T 5: 142,885,747 A578T probably damaging Het
Galr1 C T 18: 82,393,784 C319Y probably damaging Het
Gstm7 T C 3: 107,931,441 probably benign Het
Hspa1l G T 17: 34,977,970 M328I probably benign Het
Itgad A T 7: 128,190,152 Y596F probably damaging Het
Krt19 T A 11: 100,140,942 N395Y possibly damaging Het
Lrit1 G A 14: 37,061,707 A331T probably damaging Het
Mmp1b C T 9: 7,386,346 V192I possibly damaging Het
Mrc1 C T 2: 14,248,924 A252V probably damaging Het
Mucl2 C T 15: 103,899,179 probably null Het
Nbeal1 A G 1: 60,260,300 D1265G probably benign Het
Ndc1 T C 4: 107,390,426 I477T probably benign Het
Neo1 A G 9: 58,990,262 F137S probably benign Het
Nup133 T C 8: 123,907,761 I1031V probably damaging Het
Nup98 A G 7: 102,186,652 Y195H probably damaging Het
Obscn C T 11: 59,136,134 C81Y probably damaging Het
Olfr338 A G 2: 36,377,390 I205V probably benign Het
Pfn2 T C 3: 57,845,335 D55G probably damaging Het
Pif1 A G 9: 65,592,217 K485R probably damaging Het
Polr1e A G 4: 45,018,727 E19G probably damaging Het
Prkdc T A 16: 15,673,760 probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Psd T C 19: 46,322,461 K383R probably damaging Het
Ptcd1 A G 5: 145,155,134 L385P probably damaging Het
Ptpra T G 2: 130,545,049 I620S probably damaging Het
Rad54l2 T A 9: 106,688,851 probably benign Het
Sgsm1 A T 5: 113,284,995 N262K probably damaging Het
Stat1 G T 1: 52,147,883 V450F probably benign Het
Thada G A 17: 84,429,096 T919I probably benign Het
Thsd7a A T 6: 12,468,993 L529I probably damaging Het
Ttn A G 2: 76,918,519 V4062A probably benign Het
Usp9y A C Y: 1,332,662 probably benign Het
Vmn2r98 A G 17: 19,065,269 Y117C possibly damaging Het
Wdr33 A T 18: 31,827,340 H19L possibly damaging Het
Wdr76 C A 2: 121,542,418 H575Q probably benign Het
Xab2 A G 8: 3,613,875 V348A probably damaging Het
Zfhx2 A T 14: 55,072,750 Y780N possibly damaging Het
Zmynd12 T C 4: 119,444,884 probably null Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTACCCTGAGCTTTGG -3'
(R):5'- GACTCAGTCTCTTTGGCAAATCTG -3'

Sequencing Primer
(F):5'- TGGCTAACCCTTGGTGGAG -3'
(R):5'- TCTAGAGTTCTGGGAGCCAACAC -3'
Posted On 2021-08-31