Incidental Mutation 'R8952:Vmn2r98'
ID 681724
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R8952 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19065269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 117 (Y117C)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: Y117C

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: Y117C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,285,979 N758S probably damaging Het
Asb3 C A 11: 31,058,959 Q287K probably damaging Het
Bach1 T A 16: 87,715,465 N25K probably damaging Het
BC024978 T A 7: 27,200,600 S134T probably damaging Het
Carmil2 T A 8: 105,690,766 V552E possibly damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dock3 A G 9: 106,973,759 F848S probably benign Het
Dytn G A 1: 63,658,952 R299C Het
Fbxl18 C T 5: 142,885,747 A578T probably damaging Het
Galr1 C T 18: 82,393,784 C319Y probably damaging Het
Gstm7 T C 3: 107,931,441 probably benign Het
Hspa1l G T 17: 34,977,970 M328I probably benign Het
Itgad A T 7: 128,190,152 Y596F probably damaging Het
Krt19 T A 11: 100,140,942 N395Y possibly damaging Het
Lrit1 G A 14: 37,061,707 A331T probably damaging Het
Mmp1b C T 9: 7,386,346 V192I possibly damaging Het
Mrc1 C T 2: 14,248,924 A252V probably damaging Het
Mucl2 C T 15: 103,899,179 probably null Het
Nbeal1 A G 1: 60,260,300 D1265G probably benign Het
Ndc1 T C 4: 107,390,426 I477T probably benign Het
Neo1 A G 9: 58,990,262 F137S probably benign Het
Nos2 A G 11: 78,945,263 N384S probably benign Het
Nup133 T C 8: 123,907,761 I1031V probably damaging Het
Nup98 A G 7: 102,186,652 Y195H probably damaging Het
Obscn C T 11: 59,136,134 C81Y probably damaging Het
Olfr338 A G 2: 36,377,390 I205V probably benign Het
Pfn2 T C 3: 57,845,335 D55G probably damaging Het
Pif1 A G 9: 65,592,217 K485R probably damaging Het
Polr1e A G 4: 45,018,727 E19G probably damaging Het
Prkdc T A 16: 15,673,760 probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Psd T C 19: 46,322,461 K383R probably damaging Het
Ptcd1 A G 5: 145,155,134 L385P probably damaging Het
Ptpra T G 2: 130,545,049 I620S probably damaging Het
Rad54l2 T A 9: 106,688,851 probably benign Het
Sgsm1 A T 5: 113,284,995 N262K probably damaging Het
Stat1 G T 1: 52,147,883 V450F probably benign Het
Thada G A 17: 84,429,096 T919I probably benign Het
Thsd7a A T 6: 12,468,993 L529I probably damaging Het
Ttn A G 2: 76,918,519 V4062A probably benign Het
Usp9y A C Y: 1,332,662 probably benign Het
Wdr33 A T 18: 31,827,340 H19L possibly damaging Het
Wdr76 C A 2: 121,542,418 H575Q probably benign Het
Xab2 A G 8: 3,613,875 V348A probably damaging Het
Zfhx2 A T 14: 55,072,750 Y780N possibly damaging Het
Zmynd12 T C 4: 119,444,884 probably null Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTAATCTGTTCATGGGAAGGC -3'
(R):5'- CAATCCAAATTTTCTCACCTGTGG -3'

Sequencing Primer
(F):5'- GTTCATGGGAAGGCAAATAAATTAC -3'
(R):5'- CCTGTGGAAATTTAAAGAGTTGAAGC -3'
Posted On 2021-08-31