Incidental Mutation 'R8952:Vmn2r98'
ID 681724
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 068714-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8952 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19285531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 117 (Y117C)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: Y117C

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: Y117C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actmap T A 7: 26,900,025 (GRCm39) S134T probably damaging Het
Adamts12 A G 15: 11,286,065 (GRCm39) N758S probably damaging Het
Asb3 C A 11: 31,008,959 (GRCm39) Q287K probably damaging Het
Bach1 T A 16: 87,512,353 (GRCm39) N25K probably damaging Het
Carmil2 T A 8: 106,417,398 (GRCm39) V552E possibly damaging Het
Cyth4 A G 15: 78,486,937 (GRCm39) I22V probably benign Het
Dock3 A G 9: 106,850,958 (GRCm39) F848S probably benign Het
Dytn G A 1: 63,698,111 (GRCm39) R299C Het
Fbxl18 C T 5: 142,871,502 (GRCm39) A578T probably damaging Het
Galr1 C T 18: 82,411,909 (GRCm39) C319Y probably damaging Het
Gstm7 T C 3: 107,838,757 (GRCm39) probably benign Het
Hspa1l G T 17: 35,196,946 (GRCm39) M328I probably benign Het
Itgad A T 7: 127,789,324 (GRCm39) Y596F probably damaging Het
Krt19 T A 11: 100,031,768 (GRCm39) N395Y possibly damaging Het
Lrit1 G A 14: 36,783,664 (GRCm39) A331T probably damaging Het
Mmp1b C T 9: 7,386,346 (GRCm39) V192I possibly damaging Het
Mrc1 C T 2: 14,253,735 (GRCm39) A252V probably damaging Het
Mucl2 C T 15: 103,929,445 (GRCm39) probably null Het
Nbeal1 A G 1: 60,299,459 (GRCm39) D1265G probably benign Het
Ndc1 T C 4: 107,247,623 (GRCm39) I477T probably benign Het
Neo1 A G 9: 58,897,545 (GRCm39) F137S probably benign Het
Nos2 A G 11: 78,836,089 (GRCm39) N384S probably benign Het
Nup133 T C 8: 124,634,500 (GRCm39) I1031V probably damaging Het
Nup98 A G 7: 101,835,859 (GRCm39) Y195H probably damaging Het
Obscn C T 11: 59,026,960 (GRCm39) C81Y probably damaging Het
Or1j10 A G 2: 36,267,402 (GRCm39) I205V probably benign Het
Pfn2 T C 3: 57,752,756 (GRCm39) D55G probably damaging Het
Pif1 A G 9: 65,499,499 (GRCm39) K485R probably damaging Het
Polr1e A G 4: 45,018,727 (GRCm39) E19G probably damaging Het
Prkdc T A 16: 15,491,624 (GRCm39) probably benign Het
Proca1 A C 11: 78,095,773 (GRCm39) H135P probably benign Het
Psd T C 19: 46,310,900 (GRCm39) K383R probably damaging Het
Ptcd1 A G 5: 145,091,944 (GRCm39) L385P probably damaging Het
Ptpra T G 2: 130,386,969 (GRCm39) I620S probably damaging Het
Rad54l2 T A 9: 106,566,050 (GRCm39) probably benign Het
Sgsm1 A T 5: 113,432,861 (GRCm39) N262K probably damaging Het
Stat1 G T 1: 52,187,042 (GRCm39) V450F probably benign Het
Thada G A 17: 84,736,524 (GRCm39) T919I probably benign Het
Thsd7a A T 6: 12,468,992 (GRCm39) L529I probably damaging Het
Ttn A G 2: 76,748,863 (GRCm39) V4062A probably benign Het
Usp9y A C Y: 1,332,662 (GRCm39) probably benign Het
Wdr33 A T 18: 31,960,393 (GRCm39) H19L possibly damaging Het
Wdr76 C A 2: 121,372,899 (GRCm39) H575Q probably benign Het
Xab2 A G 8: 3,663,875 (GRCm39) V348A probably damaging Het
Zfhx2 A T 14: 55,310,207 (GRCm39) Y780N possibly damaging Het
Zmynd12 T C 4: 119,302,081 (GRCm39) probably null Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTTAATCTGTTCATGGGAAGGC -3'
(R):5'- CAATCCAAATTTTCTCACCTGTGG -3'

Sequencing Primer
(F):5'- GTTCATGGGAAGGCAAATAAATTAC -3'
(R):5'- CCTGTGGAAATTTAAAGAGTTGAAGC -3'
Posted On 2021-08-31