Incidental Mutation 'R8953:Pparg'
ID 681756
Institutional Source Beutler Lab
Gene Symbol Pparg
Ensembl Gene ENSMUSG00000000440
Gene Name peroxisome proliferator activated receptor gamma
Synonyms Ppar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8953 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115360951-115490399 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115441546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 92 (L92P)
Ref Sequence ENSEMBL: ENSMUSP00000144975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732] [ENSMUST00000204305] [ENSMUST00000205213]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000000450
AA Change: L122P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: L122P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171644
AA Change: L92P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: L92P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203732
AA Change: L92P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: L92P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000145083
Gene: ENSMUSG00000000440
AA Change: L92P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205213
AA Change: L92P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144975
Gene: ENSMUSG00000000440
AA Change: L92P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.1e-33 PFAM
ZnF_C4 106 176 1.1e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
Abca17 C A 17: 24,299,041 V765L probably benign Het
Atp2b2 T A 6: 113,760,669 T915S possibly damaging Het
BC017158 T G 7: 128,273,506 Q423H probably benign Het
Cacna1s C T 1: 136,097,432 H992Y possibly damaging Het
Clpp T A 17: 56,991,373 M113K probably damaging Het
Csn3 A G 5: 87,929,950 Q105R possibly damaging Het
Dcaf1 G A 9: 106,858,343 R830Q possibly damaging Het
Dnah17 A T 11: 118,125,412 probably benign Het
Etv4 A G 11: 101,771,687 probably null Het
Fos A G 12: 85,476,052 D246G probably benign Het
Foxo1 T C 3: 52,346,254 S613P probably damaging Het
Gabra2 A T 5: 71,006,182 C261S probably damaging Het
Garem1 A T 18: 21,131,331 probably null Het
Gatsl3 A T 11: 4,221,249 I244F probably benign Het
Gm10436 A G 12: 88,177,300 C248R probably benign Het
Gmip T G 8: 69,816,777 L533R probably damaging Het
Gpr1 A G 1: 63,183,113 L321P probably damaging Het
Havcr1 A G 11: 46,756,179 T147A possibly damaging Het
Helz2 C T 2: 181,233,091 R1870Q probably damaging Het
Kcnk3 A C 5: 30,622,038 K144T probably damaging Het
Lama5 A G 2: 180,193,520 V1293A probably damaging Het
Man2b1 A G 8: 85,091,910 I498V probably benign Het
Map6 T C 7: 99,315,871 L289P probably damaging Het
Mapk7 G T 11: 61,492,966 D43E possibly damaging Het
Medag A G 5: 149,427,300 Y194C probably damaging Het
Mertk A G 2: 128,778,796 probably benign Het
Mier3 C A 13: 111,706,053 T136K probably benign Het
Ndc1 T A 4: 107,381,693 W242R probably damaging Het
Nlrp1b A G 11: 71,161,806 V932A probably damaging Het
Olfr1138 A T 2: 87,738,027 M99K probably benign Het
Olfr164 T A 16: 19,286,519 M75L probably benign Het
Olfr460 G T 6: 40,571,742 A119S possibly damaging Het
Olfr476 G A 7: 107,968,044 V216I probably benign Het
Otub2 A T 12: 103,404,326 D289V probably damaging Het
P2rx3 A G 2: 85,023,498 V133A possibly damaging Het
Pde4a C A 9: 21,210,734 T585K probably damaging Het
Pik3c2a A T 7: 116,388,085 Y534N probably benign Het
Pip5kl1 A G 2: 32,579,979 D232G possibly damaging Het
Pklr C T 3: 89,142,305 S234L probably damaging Het
Pkn1 T C 8: 83,684,186 K271E probably damaging Het
Plch1 T G 3: 63,731,705 H449P possibly damaging Het
Ptgdr2 C T 19: 10,940,422 T101I probably benign Het
Rad54l2 A T 9: 106,693,262 H1286Q probably benign Het
Ralgapa1 A G 12: 55,820,761 S3P probably damaging Het
Rictor G A 15: 6,794,447 V1598I probably benign Het
Rph3al G T 11: 75,906,575 C98* probably null Het
Rpn2 A G 2: 157,321,826 T613A probably damaging Het
Rps20 T A 4: 3,834,617 M82L probably benign Het
Sh3bp4 A G 1: 89,144,437 I336V probably damaging Het
Slc6a20b T C 9: 123,609,189 N174S probably damaging Het
Spta1 A G 1: 174,230,675 N1903S probably benign Het
Ssfa2 T C 2: 79,660,495 Y986H probably damaging Het
Tacc2 T C 7: 130,625,757 S1391P probably benign Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Trhde T A 10: 114,503,061 I615F probably damaging Het
Ttc13 T C 8: 124,675,349 N556S probably damaging Het
Ttn T A 2: 76,737,884 D19228V probably damaging Het
Unc13c T A 9: 73,932,762 Y269F probably benign Het
Usp33 T A 3: 152,374,783 V517E possibly damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Zfp318 T A 17: 46,420,430 S1120T probably benign Het
Zfr2 C A 10: 81,248,437 N650K probably damaging Het
Znfx1 G A 2: 167,055,501 T501I probably damaging Het
Other mutations in Pparg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
Energy UTSW 6 115451044 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R2339:Pparg UTSW 6 115451044 missense probably damaging 1.00
R4429:Pparg UTSW 6 115440023 missense probably benign 0.09
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R4946:Pparg UTSW 6 115451028 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R5523:Pparg UTSW 6 115490071 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
R6994:Pparg UTSW 6 115451050 missense probably benign 0.36
R7177:Pparg UTSW 6 115441620 missense probably benign 0.40
R7755:Pparg UTSW 6 115463106 missense probably damaging 1.00
R8103:Pparg UTSW 6 115473141 missense possibly damaging 0.91
R8496:Pparg UTSW 6 115463151 missense probably benign 0.00
R8914:Pparg UTSW 6 115463172 missense probably benign 0.00
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGCCTCTTCTGAGACAGTAAAG -3'
(R):5'- TGAGTTCTGCCAAAACAACTCC -3'

Sequencing Primer
(F):5'- CTCTTCTGAGACAGTAAAGTTATGGC -3'
(R):5'- AATTCTTAGAGTGAGTTTGTAACAGG -3'
Posted On 2021-08-31