Incidental Mutation 'R8953:Map6'
ID 681757
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 068789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8953 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98965078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 289 (L289P)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: L492P

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107100
AA Change: L289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: L289P

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: L492P

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: L492P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208605
AA Change: L289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: L289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,892,002 (GRCm39) V88A probably benign Het
Abca17 C A 17: 24,518,015 (GRCm39) V765L probably benign Het
Atp2b2 T A 6: 113,737,630 (GRCm39) T915S possibly damaging Het
Cacna1s C T 1: 136,025,170 (GRCm39) H992Y possibly damaging Het
Castor1 A T 11: 4,171,249 (GRCm39) I244F probably benign Het
Clpp T A 17: 57,298,373 (GRCm39) M113K probably damaging Het
Cmklr2 A G 1: 63,222,272 (GRCm39) L321P probably damaging Het
Csn3 A G 5: 88,077,809 (GRCm39) Q105R possibly damaging Het
Dcaf1 G A 9: 106,735,542 (GRCm39) R830Q possibly damaging Het
Dnah17 A T 11: 118,016,238 (GRCm39) probably benign Het
Etv4 A G 11: 101,662,513 (GRCm39) probably null Het
Fos A G 12: 85,522,826 (GRCm39) D246G probably benign Het
Foxo1 T C 3: 52,253,675 (GRCm39) S613P probably damaging Het
Gabra2 A T 5: 71,163,525 (GRCm39) C261S probably damaging Het
Garem1 A T 18: 21,264,388 (GRCm39) probably null Het
Gmip T G 8: 70,269,427 (GRCm39) L533R probably damaging Het
Havcr1 A G 11: 46,647,006 (GRCm39) T147A possibly damaging Het
Helz2 C T 2: 180,874,884 (GRCm39) R1870Q probably damaging Het
Itprid2 T C 2: 79,490,839 (GRCm39) Y986H probably damaging Het
Kcnk3 A C 5: 30,779,382 (GRCm39) K144T probably damaging Het
Lama5 A G 2: 179,835,313 (GRCm39) V1293A probably damaging Het
Man2b1 A G 8: 85,818,539 (GRCm39) I498V probably benign Het
Mapk7 G T 11: 61,383,792 (GRCm39) D43E possibly damaging Het
Medag A G 5: 149,350,765 (GRCm39) Y194C probably damaging Het
Mertk A G 2: 128,620,716 (GRCm39) probably benign Het
Mier3 C A 13: 111,842,587 (GRCm39) T136K probably benign Het
Ndc1 T A 4: 107,238,890 (GRCm39) W242R probably damaging Het
Nlrp1b A G 11: 71,052,632 (GRCm39) V932A probably damaging Het
Or2m12 T A 16: 19,105,269 (GRCm39) M75L probably benign Het
Or5p55 G A 7: 107,567,251 (GRCm39) V216I probably benign Het
Or5w15 A T 2: 87,568,371 (GRCm39) M99K probably benign Het
Or9a4 G T 6: 40,548,676 (GRCm39) A119S possibly damaging Het
Otub2 A T 12: 103,370,585 (GRCm39) D289V probably damaging Het
P2rx3 A G 2: 84,853,842 (GRCm39) V133A possibly damaging Het
Pde4a C A 9: 21,122,030 (GRCm39) T585K probably damaging Het
Pik3c2a A T 7: 115,987,320 (GRCm39) Y534N probably benign Het
Pip5kl1 A G 2: 32,469,991 (GRCm39) D232G possibly damaging Het
Pklr C T 3: 89,049,612 (GRCm39) S234L probably damaging Het
Pkn1 T C 8: 84,410,815 (GRCm39) K271E probably damaging Het
Plch1 T G 3: 63,639,126 (GRCm39) H449P possibly damaging Het
Pparg T C 6: 115,418,507 (GRCm39) L92P possibly damaging Het
Pramel51 A G 12: 88,144,070 (GRCm39) C248R probably benign Het
Ptgdr2 C T 19: 10,917,786 (GRCm39) T101I probably benign Het
Rad54l2 A T 9: 106,570,461 (GRCm39) H1286Q probably benign Het
Ralgapa1 A G 12: 55,867,546 (GRCm39) S3P probably damaging Het
Rictor G A 15: 6,823,928 (GRCm39) V1598I probably benign Het
Rph3al G T 11: 75,797,401 (GRCm39) C98* probably null Het
Rpn2 A G 2: 157,163,746 (GRCm39) T613A probably damaging Het
Rps20 T A 4: 3,834,617 (GRCm39) M82L probably benign Het
Rusf1 T G 7: 127,872,678 (GRCm39) Q423H probably benign Het
Sh3bp4 A G 1: 89,072,159 (GRCm39) I336V probably damaging Het
Slc6a20b T C 9: 123,438,254 (GRCm39) N174S probably damaging Het
Spta1 A G 1: 174,058,241 (GRCm39) N1903S probably benign Het
Tacc2 T C 7: 130,227,487 (GRCm39) S1391P probably benign Het
Terb1 T A 8: 105,195,431 (GRCm39) D570V probably damaging Het
Trhde T A 10: 114,338,966 (GRCm39) I615F probably damaging Het
Ttc13 T C 8: 125,402,088 (GRCm39) N556S probably damaging Het
Ttn T A 2: 76,568,228 (GRCm39) D19228V probably damaging Het
Unc13c T A 9: 73,840,044 (GRCm39) Y269F probably benign Het
Usp33 T A 3: 152,080,420 (GRCm39) V517E possibly damaging Het
Wee1 A G 7: 109,723,691 (GRCm39) D202G probably benign Het
Zfp318 T A 17: 46,731,356 (GRCm39) S1120T probably benign Het
Zfr2 C A 10: 81,084,271 (GRCm39) N650K probably damaging Het
Znfx1 G A 2: 166,897,421 (GRCm39) T501I probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCATGGACTGACATCAAGC -3'
(R):5'- TCTCAAATACAGAGTCAGATGTGC -3'

Sequencing Primer
(F):5'- CATGGACTGACATCAAGCCTGTG -3'
(R):5'- TGTGCCAAATGTTAAGCCGC -3'
Posted On 2021-08-31