Incidental Mutation 'R0734:Meltf'
ID68177
Institutional Source Beutler Lab
Gene Symbol Meltf
Ensembl Gene ENSMUSG00000022780
Gene Namemelanotransferrin
SynonymsMTf, CD228, melanotransferrin, Mfi2
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0734 (G1)
Quality Score168
Status Validated
Chromosome16
Chromosomal Location31878810-31899020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31881958 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 99 (Y99N)
Ref Sequence ENSEMBL: ENSMUSP00000023464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023464]
Predicted Effect probably damaging
Transcript: ENSMUST00000023464
AA Change: Y99N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780
AA Change: Y99N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Meta Mutation Damage Score 0.8730 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Meltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Meltf APN 16 31888985 missense probably damaging 1.00
IGL02942:Meltf APN 16 31890778 nonsense probably null
IGL03340:Meltf APN 16 31892784 missense probably damaging 1.00
R1023:Meltf UTSW 16 31884960 missense probably damaging 1.00
R1751:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1767:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1851:Meltf UTSW 16 31896577 missense probably benign 0.00
R1900:Meltf UTSW 16 31881969 critical splice donor site probably null
R1993:Meltf UTSW 16 31892622 nonsense probably null
R3423:Meltf UTSW 16 31896525 nonsense probably null
R3425:Meltf UTSW 16 31896525 nonsense probably null
R3804:Meltf UTSW 16 31884998 missense probably benign 0.23
R4724:Meltf UTSW 16 31892505 missense probably benign 0.03
R4976:Meltf UTSW 16 31894714 missense probably benign 0.01
R5007:Meltf UTSW 16 31887562 missense possibly damaging 0.60
R5058:Meltf UTSW 16 31887603 splice site probably null
R5534:Meltf UTSW 16 31890814 critical splice donor site probably null
R5661:Meltf UTSW 16 31881926 missense possibly damaging 0.65
R6028:Meltf UTSW 16 31887476 missense possibly damaging 0.91
R6424:Meltf UTSW 16 31880262 nonsense probably null
R6464:Meltf UTSW 16 31890776 missense probably benign 0.19
R6479:Meltf UTSW 16 31881882 missense probably damaging 1.00
R6525:Meltf UTSW 16 31888899 nonsense probably null
R6629:Meltf UTSW 16 31885076 missense probably damaging 1.00
R6964:Meltf UTSW 16 31880162 missense probably benign 0.41
R7133:Meltf UTSW 16 31892799 missense probably damaging 1.00
R7169:Meltf UTSW 16 31880162 missense probably benign 0.41
R7198:Meltf UTSW 16 31883799 missense possibly damaging 0.61
R7212:Meltf UTSW 16 31890814 critical splice donor site probably null
R7246:Meltf UTSW 16 31894862 missense probably damaging 1.00
R7407:Meltf UTSW 16 31894735 missense probably damaging 1.00
R7424:Meltf UTSW 16 31884946 missense probably damaging 1.00
R7475:Meltf UTSW 16 31881938 missense probably benign 0.12
R7727:Meltf UTSW 16 31883794 missense probably damaging 0.99
X0062:Meltf UTSW 16 31880200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAGAAGGCCGTGTAACCCTC -3'
(R):5'- AGAACAGACTCAGCTTGCCAGTCC -3'

Sequencing Primer
(F):5'- CGTGTAACCCTCCCGTG -3'
(R):5'- CCTGGTTCTCCCACTTAAAGG -3'
Posted On2013-09-03