Mutagenetix > Incidental Mutation

Incidental Mutation 'R8954:Trpm1'

681832

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8954 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64208341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 177 (V177I)

Ref Sequence

ENSEMBL: ENSMUSP00000146265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: V310I

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: V310I

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000177102
AA Change: V194I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: V194I

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000205348
AA Change: V310I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably damaging
Transcript: ENSMUST00000205731
AA Change: V194I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: V194I

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206277
AA Change: V310I

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably damaging
Transcript: ENSMUST00000206706
AA Change: V177I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	T	7: 118,794,578	T450S	possibly damaging	Het
9930021J03Rik	A	T	19: 29,718,726	N1122K	possibly damaging	Het
Accsl	T	A	2: 93,857,954	Y445F	probably benign	Het
Actn4	T	C	7: 28,895,158	D815G	probably damaging	Het
Adam4	T	C	12: 81,420,372	S492G	possibly damaging	Het
Anapc2	A	G	2: 25,280,478	K643E	probably benign	Het
Ankfy1	T	A	11: 72,750,491	I630K	possibly damaging	Het
Arhgap24	A	G	5: 102,892,270	T361A	probably benign	Het
Arhgef28	T	C	13: 97,929,633	M1571V	probably benign	Het
Arid5b	A	C	10: 68,101,980	V196G	possibly damaging	Het
Art2b	C	A	7: 101,579,903		probably null	Het
Asxl3	G	A	18: 22,517,750	R932H	probably damaging	Het
B3galnt1	T	C	3: 69,575,340	N196S	possibly damaging	Het
C5ar2	C	A	7: 16,237,808	V65F	possibly damaging	Het
Cfap54	A	T	10: 93,043,393	L403Q	probably damaging	Het
Cfap74	G	A	4: 155,436,730	E620K		Het
Chac1	C	T	2: 119,353,355	A146V	probably damaging	Het
Cpne2	T	A	8: 94,558,146	S317T	probably damaging	Het
Cux1	T	A	5: 136,373,349	K138*	probably null	Het
Cwc22	T	A	2: 77,924,593	Y214F	probably damaging	Het
Cyp2c39	A	T	19: 39,536,753	T167S	probably benign	Het
Cyp4a12a	T	A	4: 115,328,738	Y414*	probably null	Het
Dap3	A	T	3: 88,928,263	D256E	probably damaging	Het
Dmxl2	C	T	9: 54,473,872	S110N	probably benign	Het
Dnhd1	A	T	7: 105,694,779	I1777L	probably benign	Het
Ecel1	G	A	1: 87,148,627	Q717*	probably null	Het
Eif3j2	G	A	18: 43,477,634	T38M	possibly damaging	Het
Fam205c	G	T	4: 42,871,753	D207E	probably damaging	Het
Fat3	T	C	9: 16,376,568	H553R	probably benign	Het
Fcho2	T	C	13: 98,777,477	D204G	probably benign	Het
Frmpd1	A	T	4: 45,284,702	E1174D	probably benign	Het
Gabra6	T	A	11: 42,315,132	Y299F	probably damaging	Het
Gak	G	A	5: 108,629,652		probably benign	Het
Gapdhs	T	A	7: 30,733,166	H214L	probably damaging	Het
Gapvd1	T	C	2: 34,678,098	Y1418C	probably damaging	Het
Gk5	C	A	9: 96,177,509	D471E	probably benign	Het
Glg1	A	G	8: 111,187,895	M419T	probably damaging	Het
Gm11639	T	G	11: 105,018,699		probably null	Het
Hist3h2a	T	A	11: 58,954,959	N74K	possibly damaging	Het
Ice1	T	C	13: 70,610,578	N215S	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ifitm10	T	C	7: 142,328,563	N157D	probably benign	Het
Itga11	A	G	9: 62,769,263	D911G	possibly damaging	Het
Kcnt1	A	G	2: 25,894,326	N247S	probably benign	Het
Kirrel	T	C	3: 87,089,866	T265A	probably benign	Het
Klhl29	A	T	12: 5,137,542	L274H	possibly damaging	Het
Kmt2b	T	G	7: 30,574,215	T2326P	probably damaging	Het
Lcn11	A	G	2: 25,779,253	S141G	probably benign	Het
Ldb3	T	C	14: 34,555,344	R358G	probably null	Het
Ldlr	G	A	9: 21,739,532	D446N	possibly damaging	Het
Lipt2	T	C	7: 100,160,242	F179L	probably damaging	Het
Lmbrd1	G	T	1: 24,706,040	V154F	possibly damaging	Het
Malrd1	A	G	2: 15,551,367	I99V		Het
Map1b	T	A	13: 99,434,227	E662V	unknown	Het
Mfsd11	T	C	11: 116,859,336	S100P	probably damaging	Het
Mgst1	C	T	6: 138,142,969		probably benign	Het
Mtf1	T	A	4: 124,804,856	V49D	probably damaging	Het
Mtss1	T	C	15: 58,955,137	D236G	probably damaging	Het
Myct1	C	T	10: 5,604,208	T25I	probably damaging	Het
Myh4	T	A	11: 67,252,980	F1089I	possibly damaging	Het
Nrxn1	A	T	17: 90,590,187	I835K	probably damaging	Het
Nsd3	T	A	8: 25,673,378	S595T	probably damaging	Het
Nt5c2	A	T	19: 46,888,922	S527T	probably damaging	Het
Olfr1066	C	A	2: 86,455,548	C241F	probably damaging	Het
Olfr195	T	A	16: 59,148,956	Y35*	probably null	Het
Olfr554	T	C	7: 102,640,675	V143A	probably benign	Het
Olfr661	T	A	7: 104,688,693	L226*	probably null	Het
Olfr869	A	T	9: 20,137,368	D84V	probably damaging	Het
Osbpl8	A	G	10: 111,272,192	S350G	probably benign	Het
Otoa	G	A	7: 121,145,518	W833*	probably null	Het
Pcdhga6	T	G	18: 37,708,487	I420S	probably damaging	Het
Pmfbp1	A	C	8: 109,531,801	M666L	probably benign	Het
Pola2	T	G	19: 5,948,424	D370A	probably damaging	Het
Ppip5k1	C	G	2: 121,323,220		probably benign	Het
Ppp1r12b	A	T	1: 134,834,462	D815E	probably benign	Het
Ppp4r3b	T	A	11: 29,205,669	V545E	possibly damaging	Het
Ptpn23	A	T	9: 110,392,500	N177K	probably damaging	Het
Rad9b	A	T	5: 122,344,230	S147R	probably benign	Het
Rps20	T	A	4: 3,834,617	M82L	probably benign	Het
Samd9l	C	T	6: 3,374,577	V895I	probably damaging	Het
Sbf2	T	A	7: 110,438,911	K396*	probably null	Het
Sbno2	G	T	10: 80,057,962	Q1198K	probably damaging	Het
Scp2d1	C	T	2: 144,823,966	T75I	probably damaging	Het
Shank3	T	A	15: 89,549,228	I1392N	possibly damaging	Het
Sidt1	A	G	16: 44,262,027	F532L	probably benign	Het
Smchd1	A	T	17: 71,448,757	V243D	probably damaging	Het
Smg1	T	C	7: 118,206,992	R185G	probably damaging	Het
Spag16	C	T	1: 69,996,845	S344F		Het
Spsb3	A	G	17: 24,891,519	D440G	probably damaging	Het
Themis	A	C	10: 28,789,713	S591R	probably benign	Het
Usp37	A	G	1: 74,474,984		probably null	Het
Vmn1r171	C	T	7: 23,633,100	T238I	probably damaging	Het
Vmn2r33	T	C	7: 7,551,656	M633V	probably benign	Het
Vmn2r93	T	A	17: 18,325,990	L708H	probably damaging	Het
Wdr53	T	A	16: 32,256,655	V226E	probably damaging	Het
Wdr62	T	A	7: 30,254,029	I193F	probably damaging	Het
Zfp607b	T	A	7: 27,703,962	D614E	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACAGTCACCCTTCGCTTGAC -3'
(R):5'- GTCAGATGTTTTCCCCAGTCTG -3'

Sequencing Primer
(F):5'- GACTTAGTCGAAGCATTGGTCAAC -3'
(R):5'- TGTTTTCCCCAGTCTGACAAAAAGC -3'

Posted On

2021-08-31