Incidental Mutation 'R8954:Ice1'
ID 681870
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R8954 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70610578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 215 (N215S)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: N215S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: N215S

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,794,578 T450S possibly damaging Het
9930021J03Rik A T 19: 29,718,726 N1122K possibly damaging Het
Accsl T A 2: 93,857,954 Y445F probably benign Het
Actn4 T C 7: 28,895,158 D815G probably damaging Het
Adam4 T C 12: 81,420,372 S492G possibly damaging Het
Anapc2 A G 2: 25,280,478 K643E probably benign Het
Ankfy1 T A 11: 72,750,491 I630K possibly damaging Het
Arhgap24 A G 5: 102,892,270 T361A probably benign Het
Arhgef28 T C 13: 97,929,633 M1571V probably benign Het
Arid5b A C 10: 68,101,980 V196G possibly damaging Het
Art2b C A 7: 101,579,903 probably null Het
Asxl3 G A 18: 22,517,750 R932H probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
C5ar2 C A 7: 16,237,808 V65F possibly damaging Het
Cfap54 A T 10: 93,043,393 L403Q probably damaging Het
Cfap74 G A 4: 155,436,730 E620K Het
Chac1 C T 2: 119,353,355 A146V probably damaging Het
Cpne2 T A 8: 94,558,146 S317T probably damaging Het
Cux1 T A 5: 136,373,349 K138* probably null Het
Cwc22 T A 2: 77,924,593 Y214F probably damaging Het
Cyp2c39 A T 19: 39,536,753 T167S probably benign Het
Cyp4a12a T A 4: 115,328,738 Y414* probably null Het
Dap3 A T 3: 88,928,263 D256E probably damaging Het
Dmxl2 C T 9: 54,473,872 S110N probably benign Het
Dnhd1 A T 7: 105,694,779 I1777L probably benign Het
Ecel1 G A 1: 87,148,627 Q717* probably null Het
Eif3j2 G A 18: 43,477,634 T38M possibly damaging Het
Fam205c G T 4: 42,871,753 D207E probably damaging Het
Fat3 T C 9: 16,376,568 H553R probably benign Het
Fcho2 T C 13: 98,777,477 D204G probably benign Het
Frmpd1 A T 4: 45,284,702 E1174D probably benign Het
Gabra6 T A 11: 42,315,132 Y299F probably damaging Het
Gak G A 5: 108,629,652 probably benign Het
Gapdhs T A 7: 30,733,166 H214L probably damaging Het
Gapvd1 T C 2: 34,678,098 Y1418C probably damaging Het
Gk5 C A 9: 96,177,509 D471E probably benign Het
Glg1 A G 8: 111,187,895 M419T probably damaging Het
Gm11639 T G 11: 105,018,699 probably null Het
Hist3h2a T A 11: 58,954,959 N74K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifitm10 T C 7: 142,328,563 N157D probably benign Het
Itga11 A G 9: 62,769,263 D911G possibly damaging Het
Kcnt1 A G 2: 25,894,326 N247S probably benign Het
Kirrel T C 3: 87,089,866 T265A probably benign Het
Klhl29 A T 12: 5,137,542 L274H possibly damaging Het
Kmt2b T G 7: 30,574,215 T2326P probably damaging Het
Lcn11 A G 2: 25,779,253 S141G probably benign Het
Ldb3 T C 14: 34,555,344 R358G probably null Het
Ldlr G A 9: 21,739,532 D446N possibly damaging Het
Lipt2 T C 7: 100,160,242 F179L probably damaging Het
Lmbrd1 G T 1: 24,706,040 V154F possibly damaging Het
Malrd1 A G 2: 15,551,367 I99V Het
Map1b T A 13: 99,434,227 E662V unknown Het
Mfsd11 T C 11: 116,859,336 S100P probably damaging Het
Mgst1 C T 6: 138,142,969 probably benign Het
Mtf1 T A 4: 124,804,856 V49D probably damaging Het
Mtss1 T C 15: 58,955,137 D236G probably damaging Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Myh4 T A 11: 67,252,980 F1089I possibly damaging Het
Nrxn1 A T 17: 90,590,187 I835K probably damaging Het
Nsd3 T A 8: 25,673,378 S595T probably damaging Het
Nt5c2 A T 19: 46,888,922 S527T probably damaging Het
Olfr1066 C A 2: 86,455,548 C241F probably damaging Het
Olfr195 T A 16: 59,148,956 Y35* probably null Het
Olfr554 T C 7: 102,640,675 V143A probably benign Het
Olfr661 T A 7: 104,688,693 L226* probably null Het
Olfr869 A T 9: 20,137,368 D84V probably damaging Het
Osbpl8 A G 10: 111,272,192 S350G probably benign Het
Otoa G A 7: 121,145,518 W833* probably null Het
Pcdhga6 T G 18: 37,708,487 I420S probably damaging Het
Pmfbp1 A C 8: 109,531,801 M666L probably benign Het
Pola2 T G 19: 5,948,424 D370A probably damaging Het
Ppip5k1 C G 2: 121,323,220 probably benign Het
Ppp1r12b A T 1: 134,834,462 D815E probably benign Het
Ppp4r3b T A 11: 29,205,669 V545E possibly damaging Het
Ptpn23 A T 9: 110,392,500 N177K probably damaging Het
Rad9b A T 5: 122,344,230 S147R probably benign Het
Rps20 T A 4: 3,834,617 M82L probably benign Het
Samd9l C T 6: 3,374,577 V895I probably damaging Het
Sbf2 T A 7: 110,438,911 K396* probably null Het
Sbno2 G T 10: 80,057,962 Q1198K probably damaging Het
Scp2d1 C T 2: 144,823,966 T75I probably damaging Het
Shank3 T A 15: 89,549,228 I1392N possibly damaging Het
Sidt1 A G 16: 44,262,027 F532L probably benign Het
Smchd1 A T 17: 71,448,757 V243D probably damaging Het
Smg1 T C 7: 118,206,992 R185G probably damaging Het
Spag16 C T 1: 69,996,845 S344F Het
Spsb3 A G 17: 24,891,519 D440G probably damaging Het
Themis A C 10: 28,789,713 S591R probably benign Het
Trpm1 G A 7: 64,208,341 V177I probably damaging Het
Usp37 A G 1: 74,474,984 probably null Het
Vmn1r171 C T 7: 23,633,100 T238I probably damaging Het
Vmn2r33 T C 7: 7,551,656 M633V probably benign Het
Vmn2r93 T A 17: 18,325,990 L708H probably damaging Het
Wdr53 T A 16: 32,256,655 V226E probably damaging Het
Wdr62 T A 7: 30,254,029 I193F probably damaging Het
Zfp607b T A 7: 27,703,962 D614E probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGACAGTTATCTGCTGG -3'
(R):5'- CAAACAAGCCTATGTCGAGTC -3'

Sequencing Primer
(F):5'- CTGGGGTTTAGAGTCACACTCC -3'
(R):5'- AACAAGCCTATGTCGAGTCTTGGG -3'
Posted On 2021-08-31