Incidental Mutation 'R8954:Map1b'
ID 681873
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 068790-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8954 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99570735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 662 (E662V)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: E662V
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E662V

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl T A 2: 93,688,299 (GRCm39) Y445F probably benign Het
Actn4 T C 7: 28,594,583 (GRCm39) D815G probably damaging Het
Adam4 T C 12: 81,467,146 (GRCm39) S492G possibly damaging Het
Anapc2 A G 2: 25,170,490 (GRCm39) K643E probably benign Het
Ankfy1 T A 11: 72,641,317 (GRCm39) I630K possibly damaging Het
Arhgap24 A G 5: 103,040,136 (GRCm39) T361A probably benign Het
Arhgef28 T C 13: 98,066,141 (GRCm39) M1571V probably benign Het
Arid5b A C 10: 67,937,810 (GRCm39) V196G possibly damaging Het
Art2b C A 7: 101,229,110 (GRCm39) probably null Het
Asxl3 G A 18: 22,650,807 (GRCm39) R932H probably damaging Het
B3galnt1 T C 3: 69,482,673 (GRCm39) N196S possibly damaging Het
Brd10 A T 19: 29,696,126 (GRCm39) N1122K possibly damaging Het
C5ar2 C A 7: 15,971,733 (GRCm39) V65F possibly damaging Het
Cfap54 A T 10: 92,879,255 (GRCm39) L403Q probably damaging Het
Cfap74 G A 4: 155,521,187 (GRCm39) E620K Het
Chac1 C T 2: 119,183,836 (GRCm39) A146V probably damaging Het
Cpne2 T A 8: 95,284,774 (GRCm39) S317T probably damaging Het
Cux1 T A 5: 136,402,203 (GRCm39) K138* probably null Het
Cwc22 T A 2: 77,754,937 (GRCm39) Y214F probably damaging Het
Cyp2c39 A T 19: 39,525,197 (GRCm39) T167S probably benign Het
Cyp4a12a T A 4: 115,185,935 (GRCm39) Y414* probably null Het
Dap3 A T 3: 88,835,570 (GRCm39) D256E probably damaging Het
Dmxl2 C T 9: 54,381,156 (GRCm39) S110N probably benign Het
Dnhd1 A T 7: 105,343,986 (GRCm39) I1777L probably benign Het
Ecel1 G A 1: 87,076,349 (GRCm39) Q717* probably null Het
Efcab3 T G 11: 104,909,525 (GRCm39) probably null Het
Eif3j2 G A 18: 43,610,699 (GRCm39) T38M possibly damaging Het
Fat3 T C 9: 16,287,864 (GRCm39) H553R probably benign Het
Fcho2 T C 13: 98,913,985 (GRCm39) D204G probably benign Het
Frmpd1 A T 4: 45,284,702 (GRCm39) E1174D probably benign Het
Gabra6 T A 11: 42,205,959 (GRCm39) Y299F probably damaging Het
Gak G A 5: 108,777,518 (GRCm39) probably benign Het
Gapdhs T A 7: 30,432,591 (GRCm39) H214L probably damaging Het
Gapvd1 T C 2: 34,568,110 (GRCm39) Y1418C probably damaging Het
Gk5 C A 9: 96,059,562 (GRCm39) D471E probably benign Het
Glg1 A G 8: 111,914,527 (GRCm39) M419T probably damaging Het
H2ac25 T A 11: 58,845,785 (GRCm39) N74K possibly damaging Het
Ice1 T C 13: 70,758,697 (GRCm39) N215S probably damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ifitm10 T C 7: 141,882,300 (GRCm39) N157D probably benign Het
Itga11 A G 9: 62,676,545 (GRCm39) D911G possibly damaging Het
Kcnt1 A G 2: 25,784,338 (GRCm39) N247S probably benign Het
Kirrel1 T C 3: 86,997,173 (GRCm39) T265A probably benign Het
Klhl29 A T 12: 5,187,542 (GRCm39) L274H possibly damaging Het
Kmt2b T G 7: 30,273,640 (GRCm39) T2326P probably damaging Het
Lcn11 A G 2: 25,669,265 (GRCm39) S141G probably benign Het
Ldb3 T C 14: 34,277,301 (GRCm39) R358G probably null Het
Ldlr G A 9: 21,650,828 (GRCm39) D446N possibly damaging Het
Lipt2 T C 7: 99,809,449 (GRCm39) F179L probably damaging Het
Lmbrd1 G T 1: 24,745,121 (GRCm39) V154F possibly damaging Het
Malrd1 A G 2: 15,556,178 (GRCm39) I99V Het
Mfsd11 T C 11: 116,750,162 (GRCm39) S100P probably damaging Het
Mgst1 C T 6: 138,119,967 (GRCm39) probably benign Het
Mtf1 T A 4: 124,698,649 (GRCm39) V49D probably damaging Het
Mtss1 T C 15: 58,826,986 (GRCm39) D236G probably damaging Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Myh4 T A 11: 67,143,806 (GRCm39) F1089I possibly damaging Het
Nrxn1 A T 17: 90,897,615 (GRCm39) I835K probably damaging Het
Nsd3 T A 8: 26,163,394 (GRCm39) S595T probably damaging Het
Nt5c2 A T 19: 46,877,361 (GRCm39) S527T probably damaging Het
Or52m1 T C 7: 102,289,882 (GRCm39) V143A probably benign Het
Or56b2 T A 7: 104,337,900 (GRCm39) L226* probably null Het
Or5k3 T A 16: 58,969,319 (GRCm39) Y35* probably null Het
Or7e175 A T 9: 20,048,664 (GRCm39) D84V probably damaging Het
Or8k28 C A 2: 86,285,892 (GRCm39) C241F probably damaging Het
Osbpl8 A G 10: 111,108,053 (GRCm39) S350G probably benign Het
Otoa G A 7: 120,744,741 (GRCm39) W833* probably null Het
Pcdhga6 T G 18: 37,841,540 (GRCm39) I420S probably damaging Het
Pmfbp1 A C 8: 110,258,433 (GRCm39) M666L probably benign Het
Pola2 T G 19: 5,998,452 (GRCm39) D370A probably damaging Het
Ppip5k1 C G 2: 121,153,701 (GRCm39) probably benign Het
Ppp1r12b A T 1: 134,762,200 (GRCm39) D815E probably benign Het
Ppp4r3b T A 11: 29,155,669 (GRCm39) V545E possibly damaging Het
Ptpn23 A T 9: 110,221,568 (GRCm39) N177K probably damaging Het
Rad9b A T 5: 122,482,293 (GRCm39) S147R probably benign Het
Rps20 T A 4: 3,834,617 (GRCm39) M82L probably benign Het
Samd9l C T 6: 3,374,577 (GRCm39) V895I probably damaging Het
Sbf2 T A 7: 110,038,118 (GRCm39) K396* probably null Het
Sbno2 G T 10: 79,893,796 (GRCm39) Q1198K probably damaging Het
Scp2d1 C T 2: 144,665,886 (GRCm39) T75I probably damaging Het
Shank3 T A 15: 89,433,431 (GRCm39) I1392N possibly damaging Het
Sidt1 A G 16: 44,082,390 (GRCm39) F532L probably benign Het
Smchd1 A T 17: 71,755,752 (GRCm39) V243D probably damaging Het
Smg1 T C 7: 117,806,215 (GRCm39) R185G probably damaging Het
Spag16 C T 1: 70,036,004 (GRCm39) S344F Het
Spata31f3 G T 4: 42,871,753 (GRCm39) D207E probably damaging Het
Spsb3 A G 17: 25,110,493 (GRCm39) D440G probably damaging Het
Themis A C 10: 28,665,709 (GRCm39) S591R probably benign Het
Trpm1 G A 7: 63,858,089 (GRCm39) V177I probably damaging Het
Usp37 A G 1: 74,514,143 (GRCm39) probably null Het
Vmn1r171 C T 7: 23,332,525 (GRCm39) T238I probably damaging Het
Vmn2r33 T C 7: 7,554,655 (GRCm39) M633V probably benign Het
Vmn2r93 T A 17: 18,546,252 (GRCm39) L708H probably damaging Het
Vps35l A T 7: 118,393,801 (GRCm39) T450S possibly damaging Het
Wdr53 T A 16: 32,075,473 (GRCm39) V226E probably damaging Het
Wdr62 T A 7: 29,953,454 (GRCm39) I193F probably damaging Het
Zfp607b T A 7: 27,403,387 (GRCm39) D614E probably benign Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AACGCAGATGGCTTCTTTGTG -3'
(R):5'- CTTCAGTGACAGAAAAGGAGGTGTC -3'

Sequencing Primer
(F):5'- ACAGAGGAGTTGATTTCTTTATGTCC -3'
(R):5'- TCCAGCAAGGAAGAGCAGTCC -3'
Posted On 2021-08-31