Incidental Mutation 'R8955:Clec4a3'
ID 681919
Institutional Source Beutler Lab
Gene Symbol Clec4a3
Ensembl Gene ENSMUSG00000043832
Gene Name C-type lectin domain family 4, member a3
Synonyms mDcir3, 3110037K17Rik
MMRRC Submission 068791-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8955 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 122929474-122946834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122943479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 100 (E100K)
Ref Sequence ENSEMBL: ENSMUSP00000144856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088468] [ENSMUST00000117173] [ENSMUST00000204427]
AlphaFold Q8JZX6
Predicted Effect possibly damaging
Transcript: ENSMUST00000088468
AA Change: E134K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085816
Gene: ENSMUSG00000043832
AA Change: E134K

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 231 1.97e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117173
AA Change: E134K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112716
Gene: ENSMUSG00000043832
AA Change: E134K

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 231 1.97e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204427
AA Change: E100K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144856
Gene: ENSMUSG00000043832
AA Change: E100K

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
SCOP:d1e87a_ 71 109 1e-8 SMART
Blast:CLECT 73 109 2e-20 BLAST
PDB:3VYK|A 73 109 7e-13 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,576,554 (GRCm39) V1003I possibly damaging Het
Adgra3 T A 5: 50,118,731 (GRCm39) Y939F probably benign Het
Adra2b T C 2: 127,205,504 (GRCm39) V2A probably benign Het
Aga T A 8: 53,974,164 (GRCm39) Y296N possibly damaging Het
Apc A G 18: 34,401,370 (GRCm39) Q52R probably damaging Het
Arfgef1 A T 1: 10,270,062 (GRCm39) S362R probably benign Het
Arhgef7 C T 8: 11,808,451 (GRCm39) probably benign Het
Bmp5 A T 9: 75,805,835 (GRCm39) M446L probably damaging Het
Carmil3 C T 14: 55,733,534 (GRCm39) T350I probably damaging Het
Cd44 T A 2: 102,683,363 (GRCm39) T224S probably damaging Het
Cep112 A T 11: 108,643,260 (GRCm39) I7F possibly damaging Het
Chrna2 G A 14: 66,379,681 (GRCm39) A7T probably benign Het
Cldn16 G A 16: 26,301,270 (GRCm39) V193I probably benign Het
Cntln C T 4: 84,986,110 (GRCm39) T1026I possibly damaging Het
Cyp4v3 T A 8: 45,761,564 (GRCm39) I420F probably benign Het
Dcbld2 G A 16: 58,271,125 (GRCm39) A301T Het
Dnah1 A T 14: 31,007,950 (GRCm39) D2152E probably benign Het
Dpy19l4 A G 4: 11,290,195 (GRCm39) V179A probably benign Het
Dusp4 T A 8: 35,284,462 (GRCm39) I259N probably damaging Het
Enpp1 T A 10: 24,544,926 (GRCm39) I318F probably benign Het
Entpd6 T C 2: 150,595,005 (GRCm39) V15A possibly damaging Het
Epb41l1 C G 2: 156,363,923 (GRCm39) Q811E probably benign Het
Epb41l5 T C 1: 119,570,292 (GRCm39) H32R probably damaging Het
Fam135b C T 15: 71,334,063 (GRCm39) V1044I possibly damaging Het
Fat4 A T 3: 39,037,778 (GRCm39) H3810L probably benign Het
Fbxw28 T A 9: 109,167,857 (GRCm39) probably null Het
Flnb T G 14: 7,892,874 (GRCm38) V648G probably damaging Het
Flnb T A 14: 7,904,688 (GRCm38) Y1030* probably null Het
Fndc3a T C 14: 72,794,410 (GRCm39) T787A probably benign Het
Gli2 T A 1: 118,783,187 (GRCm39) H106L probably damaging Het
Gm10283 T A 8: 60,954,390 (GRCm39) probably null Het
Gm3336 C T 8: 71,174,545 (GRCm39) R67* probably null Het
Gsr T G 8: 34,183,936 (GRCm39) I399M possibly damaging Het
Gtf2ird2 T A 5: 134,245,596 (GRCm39) M618K probably damaging Het
Gtf3c3 T A 1: 54,462,722 (GRCm39) D347V probably benign Het
Hspa12a T C 19: 58,788,058 (GRCm39) Y588C probably damaging Het
Il20ra A G 10: 19,635,160 (GRCm39) E467G possibly damaging Het
Inf2 A G 12: 112,576,998 (GRCm39) I991V unknown Het
Irag2 A T 6: 145,117,390 (GRCm39) M376L probably benign Het
Irx6 T C 8: 93,405,040 (GRCm39) C303R probably damaging Het
Kcnmb4 T A 10: 116,309,381 (GRCm39) K16* probably null Het
Kirrel3 T C 9: 34,855,738 (GRCm39) L86P probably damaging Het
Lipo5 A C 19: 33,450,530 (GRCm39) F21V Het
Lrrc31 T A 3: 30,733,267 (GRCm39) R482S probably benign Het
Lrrc3b C T 14: 15,358,159 (GRCm38) C149Y probably damaging Het
Lrrk1 A G 7: 65,919,573 (GRCm39) M446T probably benign Het
Macroh2a2 A T 10: 61,593,610 (GRCm39) I22N probably damaging Het
Mettl14 C T 3: 123,167,693 (GRCm39) D222N probably benign Het
Mfsd4b3-ps G A 10: 39,824,072 (GRCm39) H63Y probably benign Het
Myo16 T C 8: 10,426,175 (GRCm39) W311R probably damaging Het
Nccrp1 A T 7: 28,245,628 (GRCm39) N151K probably benign Het
Obsl1 T C 1: 75,480,493 (GRCm39) D377G probably damaging Het
Or5b97 T A 19: 12,878,578 (GRCm39) T189S probably benign Het
Or5p80 T A 7: 108,229,506 (GRCm39) C102* probably null Het
Or7c19 T A 8: 85,957,913 (GRCm39) I263N probably benign Het
Or7c70 G T 10: 78,683,576 (GRCm39) P58T probably damaging Het
Pigb T C 9: 72,945,983 (GRCm39) N63S probably damaging Het
Plch2 T C 4: 155,077,023 (GRCm39) E577G probably benign Het
Prkab2 T C 3: 97,573,943 (GRCm39) V194A probably benign Het
Psd3 T C 8: 68,416,461 (GRCm39) I479V probably benign Het
Ralgapb C A 2: 158,279,264 (GRCm39) P117T probably benign Het
Ralgapb C G 2: 158,337,389 (GRCm39) T1116R probably damaging Het
Rpap2 T A 5: 107,768,361 (GRCm39) S400T possibly damaging Het
Rpgrip1l C A 8: 92,007,456 (GRCm39) W378L possibly damaging Het
Rps20 T A 4: 3,834,617 (GRCm39) M82L probably benign Het
Rps5 T C 7: 12,659,440 (GRCm39) M77T possibly damaging Het
Scaf11 A G 15: 96,318,371 (GRCm39) S398P probably damaging Het
Sdf2 T A 11: 78,145,763 (GRCm39) D153E probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Slc12a9 T C 5: 137,329,270 (GRCm39) N128S probably damaging Het
Slc25a32 C A 15: 38,960,946 (GRCm39) G246C probably damaging Het
Slc38a4 C T 15: 96,914,662 (GRCm39) A64T probably benign Het
Slit3 T C 11: 35,589,207 (GRCm39) V1254A probably damaging Het
Slx4 T C 16: 3,808,111 (GRCm39) K481R probably benign Het
Tcea1 A G 1: 4,959,732 (GRCm39) T136A probably benign Het
Thra A G 11: 98,644,449 (GRCm39) D13G possibly damaging Het
Tmed9 G A 13: 55,744,775 (GRCm39) S227N probably benign Het
Trim80 C A 11: 115,331,538 (GRCm39) T20K probably benign Het
Trmt61a G T 12: 111,649,256 (GRCm39) V276L probably benign Het
Trpc4ap T C 2: 155,508,171 (GRCm39) D160G possibly damaging Het
Ubr5 C T 15: 38,029,825 (GRCm39) E467K Het
Vars2 C A 17: 35,972,541 (GRCm39) G26W probably damaging Het
Vmn1r226 G T 17: 20,908,287 (GRCm39) R173L possibly damaging Het
Vmn1r29 G T 6: 58,284,284 (GRCm39) M1I probably null Het
Vmn2r3 G T 3: 64,168,803 (GRCm39) P578Q possibly damaging Het
Vmn2r57 A T 7: 41,049,571 (GRCm39) I726N possibly damaging Het
Zfp39 A T 11: 58,780,946 (GRCm39) Y605* probably null Het
Other mutations in Clec4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Clec4a3 APN 6 122,929,819 (GRCm39) utr 5 prime probably benign
IGL02210:Clec4a3 APN 6 122,931,067 (GRCm39) missense probably damaging 0.98
IGL02874:Clec4a3 APN 6 122,944,519 (GRCm39) missense probably benign 0.16
IGL02983:Clec4a3 APN 6 122,944,526 (GRCm39) critical splice donor site probably null
R0035:Clec4a3 UTSW 6 122,944,508 (GRCm39) missense probably damaging 1.00
R0035:Clec4a3 UTSW 6 122,944,508 (GRCm39) missense probably damaging 1.00
R0334:Clec4a3 UTSW 6 122,946,329 (GRCm39) missense possibly damaging 0.81
R0671:Clec4a3 UTSW 6 122,930,993 (GRCm39) critical splice acceptor site probably null
R1508:Clec4a3 UTSW 6 122,944,467 (GRCm39) missense probably benign 0.05
R1739:Clec4a3 UTSW 6 122,931,000 (GRCm39) nonsense probably null
R3547:Clec4a3 UTSW 6 122,941,239 (GRCm39) missense probably damaging 1.00
R5836:Clec4a3 UTSW 6 122,929,861 (GRCm39) missense possibly damaging 0.66
R5953:Clec4a3 UTSW 6 122,946,451 (GRCm39) missense probably benign 0.12
R7178:Clec4a3 UTSW 6 122,941,251 (GRCm39) missense probably benign 0.02
R7664:Clec4a3 UTSW 6 122,943,381 (GRCm39) missense probably benign 0.03
R7763:Clec4a3 UTSW 6 122,941,299 (GRCm39) missense probably benign 0.01
R8739:Clec4a3 UTSW 6 122,944,508 (GRCm39) missense probably damaging 1.00
R8925:Clec4a3 UTSW 6 122,946,328 (GRCm39) missense probably damaging 1.00
R8927:Clec4a3 UTSW 6 122,946,328 (GRCm39) missense probably damaging 1.00
R9457:Clec4a3 UTSW 6 122,931,045 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCTTTGCACCTGAGGAGTGAG -3'
(R):5'- GTTAAGGCAACCATTCCTGC -3'

Sequencing Primer
(F):5'- CTGCTGCATCTGGAAGAAGCTG -3'
(R):5'- ATTCCTGCCTATCTACTGGAAAG -3'
Posted On 2021-08-31